1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

Answer 1
CUGCUACAUCGUAGCUGGUAAC

Related Questions

Ronald observes a sparrow's nest in a shrub outside his home. The table below describes his findings.
Week
Observations
1
Six eggs were laid in the nest.
3
Five eggs hatched, and one egg did not hatch.
One of the chicks disappeared.
7
Three of the chicks learned to fly, and another one disappeared.
What part of natural selection did Ronald observe?
adaptation
overproduction
selection
variation

Answers

Answer:

B. Overproduction

Explanation:

Overproduction is one of the main part of natural selection whereby an organism reproduces more offspring, of which only a few would be able to survive given the environmental condition amd factors that would be against the survival of the offspring to maturity.

From Ronald observation, we can see that the bird produces more eggs than would survive. Only 3 of the chicks survived.

how do organisms with many cell types develop from a single cell

Answers

Answer:

Organisms develop from a single cell into many cell types, which are organized into tissues and organs. During development, cells use both inherited info and external signals from neighbors to “decide on” their behavior and identity.

Cell division, torso axis formation, tissue and organ development are all part of development, and cell differentiation refers to acquiring a final cell type identity.

What is cell division?

The process by which a parent cell divides into two daughter cells is known as cell division.

Cell division is usually part of a larger cell cycle during which the cell grows and replicates its chromosomes before dividing.

Cell division occurs in two stages: mitosis and meiosis. When most people say "cell division," they're referring to mitosis, the process of creating new body cells.

Meiosis is the process by which egg and sperm cells are formed. Mitosis is a necessary process for life.

Multicellular organisms form in a variety of ways, including cell division and the aggregation of many single cells. Colonial organisms form when many identical individuals band together to form a colony.

Thus, this way, organisms with many cell types develop from a single cell.

For more details regarding cell division, visit:

https://brainly.com/question/13312481

#SPJ2

Mitosis is done by your body cells. What types of cells do not undergo mitosis

Answers

Answer:

Sex cells/ gametes

Explanation:

Sperm cells and egg cells don't go through mitosis

NEED ANSWER ASAP

Students in a Biology class were formulating an argument about a cell they viewed under the microscope. Half
of the class argued it was a plant cell and the other half argued in favor of an animal cell. Below is the image the
students saw under the microscope. Which argument is supported by the image?

A. The students who said the plant cell are correct because there are chloroplasts

B. The students who said a plant cell are correct because there are mitochondria present.

C. The students who said animal cell are correct because there are chloroplasts present.

D. The students who said an animal cell are correct because there are mitochondria present.

Answers

Answer:

the answer would be A

Explanation:

Animal cells are oval and egg shaped so we can cancel out c and d

A is the correct answer because we can see green dots within the structure. Chloroplasts contain a green pigment called chlorophyll. This green pigment makes the chloroplast and the structure green (as we can see in the picture). Photosynthesis occurs in the chloroplasts, and it is where the plant gets its glucose from

Hope this helps!

(GIVING BRAINLIEST!!)

Due to altitude, you might find snow here during the summer months.

A) By a lake
B) In the forest
C) In the ocean
D) On a mountain

Answers

Answer:

D

Explanation:

Since the temperature is colder at a higher altitide you can use that knowledge to think about how high these places are relative to eachother. You can then take the highest one for your answer

D

Higher up it is colder

what organelle ships proteins where they are need?​

Answers

Answer:

The endoplasmic reticulum (ER) is involved in the synthesis of lipids and synthesis and transport of proteins.

The Golgi apparatus modifies, sorts, and packages different substances for secretion out of the cell, or for use within the cell.

Vesicles are also used as chemical reaction chambers.

Explanation:

PLEASE MARK ME AS BRAINLIEST

The endoplasmic reticulum (ER) is involved in the synthesis of lipids and synthesis and transport of proteins.
The Golgi apparatus modifies, sorts, and packages different substances for secretion out of the cell, or for use within the cell.
Vesicles are also used as chemical reaction chambers.

The relationship that occurs between an orchid attached on a narra tree could be
classified as Commensalism and Parasitism. True or false?

Answers

Answer:

Yes, it's True

Explanation:

A parasitic relationship helps one of the species involved in the relationship, but harms the other organism in the process of it growing. It is a symbiotic relationship and would be classified as Commensalism. Most of the orchids are epiphytes, so they tend to grow on other plants. hope you understand. Fighting!

The relationship that occurs between an orchid attached on a narra tree could be classified as Commensalism. Thus, the given statement is true.

What is Commensalism?

Commensalism is a long-term biological interaction or symbiosis in which the members of one species gain benefits which help them in survival while those of the other species are neither benefitted nor are harmed from the association.

In contrast with mutualism, in which both the organisms benefit from each other and amensalism, where one species is harmed while the other species is unaffected and that of parasitism, where one species is harmed and the other species benefitted.

Learn more about Commensalism here:

https://brainly.com/question/14224704


#SPJ2

Mendel's law of segregation is describing or explaining which process?

a mitosis
b. binary fission
c. meiosis
d. asexual reproduction

Answers

Answer:

meiosis

Explanation:

because Mendel's law of segregation states that: “During the formation of gamete, each gene separates from each other so that each gamete carries only one allele for each gene.” Same applies to meiosis the chromosomes separate.

please answer please, If we have a male hemophiliac (such as Leopold) marry a normal female, is there any way to have sons who have hemophilia? Provide a justification for your response.

Answers

Yes, hemophilia is a genetic condition, which means it can be genetically passed down to a male child, even if only one parent is a hemophiliac. The condition is also more common in male children, and is a sex-linked recessive disorder, and is carried on the X chromosome. The mother could also have the gene without actually having the disorder, so she could possibly be a carrier without knowing it, so it is possible for their son to have hemophilia, even if the dad is the only one with the gene.
Hope this helps!!

Please help it’s due in under 1 hour!!!!!
Explain how sexual and asexual reproduction both lead to better evolutionary fitness.

Answers

Answer:

Hope you get done. friend me back. and can I have brainliest

Explanation:

To get diversity in individuals, genetic differences are required, and different phenotypes must be expressed. Since sexual reproduction is more conducive to driving evolution than asexual reproduction, much more genetic diversity is available for natural selection to work on. Evolution can happen over time.

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

How are gay marriaged babys made to be biological?

Answers

Answer:

if its a couple with a trans man (female to male) they can have a baby if they havent had surgery.

a trans woman (male to female) can also have a biological baby with a woman if they havent had surgery.

They could also have had a baby in a past relationship though it wont be biological to the other parent.

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

If the sphincter allows any leakage from the stomach, some of this acid might move back into the esophagus, causing
1. Heartburn
2. Saliva
3. Constipation
4. Diarrhea

Answers

1, heartburn. Keep stomach acid in the stomach!
Heartburn bc of the acid In your stomach

The routes nerve impulses from our senses.
A. thalamus
B. hippocampus
C. brain stem
D. corpus callosum

Answers

Answer:

a

Explanation:

The correct answer is C. Brain Stem.

How does the brain stem function?

The thalamus and other areas of the brain receive nerve signals from our senses through the brain stem. It is made up of the medulla, pons, and midbrain and is situated at the base of the brain.

The brain stem is in charge of regulating life-sustaining processes including breathing, heart rate, and blood pressure. It is also in charge of transmitting sensory data from the body to the thalamus, which subsequently transmits the data to the relevant parts of the brain.

Although the brain stem is the main pathway for nerve impulses from our senses, the hippocampus, corpus callosum, and thalamus are all important in the processing of sensory information.

Learn more about brain stem at:

https://brainly.com/question/3666013

#SPJ5

How are the functions of the endoplasmic reticulum and the Golgi apparatus related? A. Golgi apparatus receives proteins and other materials from the endoplasmic reticulum, packages them, and distributes them to vacuoles. B. The nucleus directs the cell's activity, including any transfer of material between the endoplasmic reticulum and the Golgi apparatus. C. Proteins and other substances made in the endoplasmic reticulum are stored, packaged, and distributed by the Golgi apparatus. D. In order to function, both plant and animal cells require an endoplasmic reticulum and Golgi apparatus.

Answers

Answer:

Proteins and other substances made in the endoplasmic reticulum are stored, packaged, and distributed by the Golgi apparatus

What happens during the pathway of glycolysis?

A. Glucose is broken down into private

B. Carbon dioxide is produced

C. More ATP is consumed than is produced.

D. Lactic acid is produced

Answers

Answer:

the correct answer is A :Glucose is broken down into pyruvate

Answer:

If I'm correct, the glucose is broken down into pyruvate and energy.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️

II. Which animal is the top predator in many wetlands?
A. Raccoons
B. Alligators
C. Snakes
D Owls

Answers

Answer:

b. n kkhghiuttyytrftghjiutew

Which statement is true regarding the taxonomic system?

Charles Darwin was the primary creator of the current taxonomic system.

All of the past, extinct species have been cataloged.

The current taxonomic system is based on the Linnaean classification system.

All of the current, living species in the world have been cataloged.

Answers

Answer:

1) taxonomy

2) species

3) the animal has sharp, pointed teeth

4) the current taxonomic system is based on the Linnaean system

5) he only had two kingdoms, animals and plants

Explanation:

did the quich check

The statement 'the current taxonomic system is based on the Linnaean classification system' is TRUE.

Taxonomy is a field of study focused on naming and classifying groups of organisms according to their morphological and genetic features.

The taxonomic system organizes species from larger to more specific taxonomic categories in a hierarchical system.

The botanical taxonomist Carolus Linnaeus is considered the father of taxonomy because he was the first person to formulate a system for classifying different species of plants and animals.

Nowadays, the taxonomic system includes eight (8) categories from larger to more specific: domain, kingdom, phylum, class, order, family, genus, and species.

In conclusion, the statement 'the current taxonomic system is based on the Linnaean classification system' is TRUE.

Learn more in:

https://brainly.com/question/8895545

1. Submit your observations of the chicken leg dissection.



2. Were you able to determine how the chicken moves?



3. What characteristics of muscles help you determine the direction of the movement?

Answers

Answer:

1. Submit your observations of the chicken leg dissection.

The first thing that I saw was the skin. This one has bumps on it. Underneath, when I carefully cut it, I could see a yellow layer which is fat. Under the fat, there is a thick pink tissue, the muscles. The muscle is in contact with the bones and attached to them by the tendons. They look thin and white and are at the muscles' ends since they attach them to the bones.

2. Were you able to determine how the chicken moves?

Yes, muscles work in pairs, so when I pull from a specific tendon, the leg bends since the muscle contracts to do this movement. Then this muscle will relax, another muscle will contract itself, and a tendon will pull the bone to return the leg to a straight position.

When one of these muscles contracts, the other relaxes to allow the bone's movement in a specific direction. Then this muscle relaxes and allows the leg's movement in the opposite direction since the muscle that was lax before now is contracting itself to extend the leg. There are a flexor and an extensor muscle.

3. What characteristics of muscles help you determine the direction of the movement?

The characteristics that help me determine the movement's direction were:

The position that the muscles have concerning the joints and the bones. The tendons at the end of the muscles and bones.

By following the muscle, the tendon, and where it is in the joint, I could determine the movement's direction.

Explanation:

When we observe a chicken leg dissection, we can determine the components that it has and how all the elements work together to move the leg. Even though the mechanism and structure are not the same as in a human body, we can see how muscles, bones, tendons, and joints work not only in animals but also in humans to allow movement.

Does mass alone determine whether an object will float or sink? Explain

Answers

Answer:

yes because if the mass is heavy it gonna sink, if its light its gonna float

Explanation:

Almost all __________________ use the energy stored in _________ for their life cycle

Answers

Answer: living things and I’m not fully sure what the second one is sorry

Explanation:

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

which ecosystem has the greatest biological diversity and therefore the highest sustainability

Answers

Answer:

Tropical rain forests on land and coral reefs in marine systems are among the most biologically diverse ecosystems on Earth and have become the focus of popular attention.

Explanation:

definitely D because a rainforest is extremely vast when it comes to different species

Answer:

Species richness is greatest in tropical ecosystems. Tropical rain forests on land and coral reefs in marine systems are among the most biologically diverse ecosystems on Earth and have become the focus of popular attention.

HELPP
The diagram below shows the similarities and differences of plants and animals complete the diagram by filling in the correct term as follows: heterotrophic and autotrophic and multicellular

Answers

Answer:

Both are multicellular (plants have different cells for the leaves and the stem, animals have skin cells, brain cells etc so they are called multicellular).

Plants are autotrophic - they make their own food (glucose) by photosynthesis

Animals are heterotrophic - they eat other organisms, cannot make their own food.

Explanation:

What makes echinoderms unique to all other animals? (think of systems/structures they
have that no other animal has!)

Answers

Although these spines may look like components of an exoskeleton at first glance, echinoderms do not have an exoskeleton. This is partly due to their symmetry and their spiny endoskeleton.

Please Helppp!!! What could lead to different populations of the same species living in different environments?

Answers

Answer: Migration, because species move to other places for food or a better or more suitable habitat and sometimes their is other species there.

Different ecological and biogeographical causes lead to different populations of the same species living in different environments. Ecological factors include intraspecific competition, migration, resource searching, habitat destruction, among others. Biogeographical dispersion involves wider areas and time factor. Human action is also a cause of dispersion.

-----------------------------------

Dispersion can be defined as the dissemination and distancing process of some individuals from others. It refers to the change in an organism's range or distribution area.

Different ecological and biogeographical processes might be involved in organisms' dispersion.

Ecological processes involve intraspecific competition for resources, habitat destruction, lack of resources -food or water-, among others. This is an intra-area, moderate dispersion that reduces competition and increases niche findings. It involves daily and seasonal migration and territoriality. Biogeographical processes refer to bigger changes that involve wider areas and time. It includes the historical factor, besides migration. This is an extra-area dispersion process.

            → Jumping dispersion refers to a few individuals, in a short time, that  can cross a barrier and occupy a new area. In this situation, the establishment is not always for sure. They must reproduce and start a new population of a certain size that can survive the new conditions.

            → Diffusion refers to populations that, through many generations, explores and expands in new regions with favorable conditions.

            → Secular migration is the diffusion through thousands of generations.

Dispersion is also caused by human actions, following different interests and goals.

When two populations of the same species migrate to new areas and adapt to different environmental pressures, they will probably suffer from the speciation process with time, becoming two different species.

--------------------------------

Related link: https://brainly.com/question/14333803?referrer=searchResults

The photo shows a process called mosquito fogging.
What is one purpose of mosquito fogging?
O A To prevent people from getting stek from undercooked meat
Te treat people who have infeetiens caused by Viruses
e. Te eamy waste away from eities so people dont get siek
D. To kill insects that commonly spread diseases to people

Answers

Answer:

D. To kill insects that commonly spread diseases to people

Answer:

D. To kill insects that commonly spread diseases to people

Explanation:

Fogging is a technique used for killing insects that involves using a fine pesticide spray (aerosol) which is directed by a blower.

Put "Polygenic Traits" in a sentence

Answers

Answer:

Polygenic traits are controlled by a number of separate genes.

Hope it helps! :D

Answer:

Polygenic traits are controlled by a number of separate genes

Explanation:

Hope this helps

The photograph shows solid waste pollution.
Which human lifestyle factors led to this situation? Select the three correct
responses. i’m

Answers

Answer:

A. People make things to earn a living

B. People want to buy things

D. People produce waste

Explanation:

Other Questions
How does the Nervous System work with the Digestive System?A: by telling your body when you are hungry.B : By pumping nutrients into the blood.C: By allowing you get big and strong .D. By eating food !Somebody available to help ? Which graph shows u + v for the given vectors u and v? An aluminum wire having a cross-sectional area equal to 2.20 10-6 m2 carries a current of 4.50 A. The density of aluminum is 2.70 g/cm3. Assume each aluminum atom supplies one conduction electron per atom. Find the drift speed of the electrons in the wire. how do I find a percentage from a discount please help with question Lorenzo tiene 4 cajas de huevo, cada uno con 50 huevos y 3 cartones del mismo producto con 10 de ellos Cuntos huevos hay en total? Which piece of information below will not help you prove that triangles ABC and DEF are congruent using ASA? convert 0.0345mW to MW Will be marked brainliest for answering this simple question Insurance companies are interested in knowing the population percent of drivers who always buckle up before riding in a car. They randomly survey 391 drivers and find that 319 claim to always buckle up. Construct a 85% confidence interval for the population proportion that claim to always buckle up. Beths brother is 140% of Beths height. If Beths brother measures 140cm, how tall is Beth? 2. Izza walked 5 steps forward, 8 steps backward, 9 steps forward and 3 steps backward. Howmany steps is Izza from where she started?3. Samuel was at the ground floor when he decided to go to the fourth floor. He then went down 2or and went up 7 more floors. Where is he now?On a winter night the temperature dropped f.rom -6C to -15C. How many degrees did theTamperature drop? I need someone to give me the solfege for this please I need it ASAP!!!!!!!!! TEST - chapter 832 of 32POSSIBLE POINTS: 3What are the three factors that affect the rate of photosynthesis? (Hint: These are clearly listed towardthe end of your notes). You start with 2.5g of magnesium and add it to 400mL of CO2 at 23 o C and 1atm. How many grams of magnesium oxide will be formed? Choose which statement best describes an element.A. Anything that takes up spaceB. A pure substance that cannot be broken down into other substances by chemical means. C. WaterD. Atom has a nucleus with neutrons and protons in it. change this statement in to question and then passive voice I DO MAY WORK. pls help 100 points helphelp someone please explain how to make a fraction into a decimal im confused will give brainliest to best answer also worth 25 points 14. If 100 grams of sodium nitrate are dissolved in 100 grams of waterat 60 degrees C, is the solution formed saturated, unsaturated, orsupersaturated? Steam Workshop Downloader