Answer:
Adopting sustainable and environment friendly practices
Explanation:
Sustainable and environment friendly practices allows an individual to use available resources without depleting them and hence even the future generations have adequate supply of natural resources. Afforestation and conservation of water resources specially the potable water sources need to be started immediately with massive force.
Name three reasons why the atmosphere is important to life on earth and explain your reasoning.
The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.
The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.
Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.
Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling
Answer:
OB. staffing
True or falseThe study of where organisms live and how they got to specific places is called Biodiversity .
Answer:
False
Explanation:
Correct answer is biogeography
Explanation:
Biodiversity is a term used to describe the enormous variety of life on Earth. It can be used more specifically to refer to all of the species in one region or ecosystem. Biodiversity refers to every living thing, including plants, bacteria, animals, and humans..A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy
Answer:
89.6Joules
Explanation:
Kinetic energy is 1/2MV^2
Where m is Mass and v is velocity.
M=81.6 v=2.2m/s
K.E= 1/2 × 81.6 × 2.2
= 81.6 ×1.1
K.E=89.6 Joules
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic
Explanation:
i have no clue, but good luck, hopefully you pass the test
Once in an organism, what are these atoms used for?
Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.
Answer:
d) excitabilidad
Explanation:
creo que seria esa no lo sé
no se mucho de eso
me dices si sale buena o mala
what is the meaning of
•molecule
•compound
•atom
•element
•organic compound
•inorganic compound
Molecule: a molecule is the smallest particle in a chemical element or compound that has the chemical properties of that element or compound. Molecules are made up of two or more atoms that are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons among said atoms. Although oxygen is an element, it naturally has 2 atoms (O2), because it is a halogen and in order to reach 8 valence electrons and become stable and unreactive, it bonds with another oxygen atom. This means that oxygen atoms and oxygen molecules are different; one is an element, the other is a molecule.
Pure Substance: can be divided into two sub-categories: compounds and elements.
Compound: A chemical compound is a chemical substance composed of many identical molecules composed of atoms from more than one element held together by chemical bonds. A molecule consisting of atoms of only one element is therefore not a compound, meaning that oxygen molecules (O2) are NOT compounds. NaCl, or table salt, is.
Atom: An atom is the smallest unit of ordinary matter that forms a chemical element. Every solid, liquid, gas, and plasma is composed of neutral or ionized atoms.
Element: An element is a pure substance consisting only of atoms that all have the same numbers of protons in their atomic nuclei. Elements are the base, more "pure" of the pure substances. Each element is assigned a symbol. Perhaps the most recognizable of them is H, for hydrogen.
Organic Compounds: organic compounds are generally any chemical compounds that contain carbon-hydrogen bonds. The study of these is called organic chemistry. I mean, carbon is the basis of ALL known life.
Inorganic Compounds: They are any substance in which two or more chemical elements (usually other than carbon) are combined, nearly always in definite proportions. Compounds of carbon are classified as organic when carbon is bound to hydrogen. THE OPPOSITE OF ORGANIC COMPOUNDS.
Chemistry is fun!! Hope this helps!! Have a wonderful day!!
Will mark brainliest there’s a button for the pic
I'd say FLPE is the worst. It can run high temperatures but it's not safe and not safe with all foods, it's has a high cost.
what is the name of the fluid found in the gall bladder
Answer:
"Bile" is what that fluid is called
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
Agricultural chemicals are one source of water pollution. What is one way we can reduce their effects?"
a. biological magnification
b. nonpoint source pollutant
c. integrated pest management
d. sewage treatment
Answer:
what I think it is it's C?
True or false The sea otter is considered a keystone species that influences the survival of many other species in an ecosystem .
Answer:
false
Explanation:
answer: True
kind of
Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP
molten rocck near ground water supplies
For recessive trait to be expressed you need to receive the allele from both parents. True or false
Answer:
When a trait is recessive, an individual must have two copies of a recessive allele to express the trait.
Why is the genetic code common to all organisms!
Answer:
Why Is DNA Considered a Universal Genetic Code? DNA is considered a universal genetic code because every known living organism has genes made of DNA. ... All organisms also use DNA to transcribe RNA, and then they translate that RNA into proteins. Every living organism uses that same system.
Explanation:
The genetic code is universal because it is the same among all organisms. Replication is the process of copying a molecule of DNA. Transcription is the process of converting a specific sequence of DNA into RNA.
Protein-encoding genes specify the sequences of amino acids, which are the building blocks of proteins. In turn, proteins are responsible for orchestrating nearly every function of the cell. Both protein-encoding genes and the proteins that are their gene products are absolutely essential to life as we know it.
Which of these represents an individual form of life such as an animal, plant, or single-celled life form?
Organ
Organism
Organ system
Tissue
_______________________ is an animal's ability to blend into its surroundings.
a
artificial selection
b
evolution
c
natural selection
d
camouflage
[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]
Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.Differences found in offspring?
Answer:
Chromazones
Explanation:
Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?
Answer: Stabilization selection
Explanation:
Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.
Which gas is used by humans in the process of cellular respiration?
Answer: Oxygen
Explanation:
During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.
Hope This Helps!
#[tex]AnimePower[/tex]
Answer:
oxygen
Explanation:
we breathe it in during cellular respiration
In order for water to collect in earths atmosphere and form clouds it must first undergo what process?
A) condensation
B) convection
C) evaporation
D precipitation
Answer:
The answer is D: Precipitation
What would happen to the darker colored moths if the forest was light colored?
Answer:
Dark motgs live longer in a dark forest so they had more time to breed all living things respond to natural selection.
what is the botanical name of milk
Answer:
Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.
The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.
Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.
There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.
Milk lacks a botanical name since it is a byproduct of animals, not plants.
Learn more about botanical names here:
https://brainly.com/question/20532715
#SPJ6
The image below represents two waves X and Y, traveling to the same medium at the same speed how are the two waves different?
Answer: D is right
Explanation: It seems both waves have same wavelength.
Because speed = wavelength · frequency (v = λf) and
f = v/λ, so frequency is same. Because period T = 1/ frequency, also periods are same. Wave Y has higher amplidude and its energy is greater.
Answer:
D
Explanation:
just had it on study island
please help me with this
Answer:
prob b
Explanation:
Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism
Answer:
B
Explanation:
Because cells make tissues which then combine to make organs which then further combine to form system
Which makes organisms like me and you
Answer: B
(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)
Explanation : Because cells make tissues which then combine to make organs which then further combine to form system
WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?
1. covalent because an electron is transferred from a C atom and O atom to a H atom.
2. covalent because electrons are shared between the C, H, and O atoms
3. ionic because an electron is transferred from a C atom and O atom to a H atom.
4. ionic because electrons are shared between the C, H, and O atoms
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
The atomic no. of carbon=6
Electronic configuration=2,4
The atomic no of H=1
E.C=1
The atomic no of O=8
E.C= 2,6
Therefore to attain octate state, they will share electrons
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
Took the test.
When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation
Explanation:
..........................................