24. Solve for x: 3x - 2(x - 4) = 5(2x + 4) -3

Answers

Answer 1

x=-1

3x-2x+8=10x+20-3

x+8=10x+17

-9x=9

x=-1

Answer 2

Answer:

[tex]x=-1[/tex]

Step-by-step explanation:

[tex]x-2\left(x-4\right)=5\left(2x+4\right)-3[/tex]

[tex]-2\left(x-4\right)\\\mathrm{Distribute}\\-2x+8[/tex]

[tex]3x-2x+8=5\left(2x+4\right)-3[/tex]

[tex]\mathrm{Combine\: like\: terms}[/tex]

[tex]x+8=5\left(2x+4\right)-3[/tex]

[tex]\left(2x+4\right)-3\\\mathrm{Distribute}\\10x+20-3\\10x+17[/tex]

[tex]x+8=10x+17[/tex]

[tex]\mathrm{Subtract\:}8\mathrm{\:from\:both\:sides}[/tex]

[tex]x+8-8=10x+17-8[/tex]

[tex]x=10x+9[/tex]

[tex]\mathrm{Subtract\:}10x\mathrm{\:from\:both\:sides}[/tex]

[tex]x-10x=10x+9-10x[/tex]

[tex]-9x=9[/tex]

[tex]\mathrm{Divide\:both\:sides\:by\:}-9[/tex]

[tex]\frac{-9x}{-9}=\frac{9}{-9}[/tex]

[tex]\bold{x=-1}[/tex]


Related Questions

Find an equation of the line having the given slope and containing the given point. Slope 7 through (6,3)​

Answers

[tex](\stackrel{x_1}{6}~,~\stackrel{y_1}{3})~\hspace{10em} \stackrel{slope}{m}\implies 7 \\\\\\ \begin{array}{|c|ll} \cline{1-1} \textit{point-slope form}\\ \cline{1-1} \\ y-y_1=m(x-x_1) \\\\ \cline{1-1} \end{array}\implies y-\stackrel{y_1}{3}=\stackrel{m}{7}(x-\stackrel{x_1}{6}) \\\\\\ y-3=7x-42\implies y = 7x-39[/tex]

Answer:

[tex]y-3=7(x-6)[/tex]

Step-by-step explanation:

Pre-Solving

We are given that a line has a slope (m) of 7 and passes through the point (6,3).

We want to write the equation of this line.

There are three ways to do it:

Slope-intercept form, which is y=mx+b where m is the slope and b is the value of y at the y-intercept.Point-slope form, which is [tex]y-y_1=m(x-x_1)[/tex] where m is the slope and [tex](x_1,y_1)[/tex] is a point. Standard form, which is ax+by=c where a, b, and c are free integer coefficients.

As the question doesn't specify, either form should work, but let's write the equation in point-slope form as that's the easiest to do.

Solving

As we are already given both the point and the slope, we can plug them both into the equation.

Starting with the slope, substitute 7 for m.

[tex]y-y_1=7(x-x_1)[/tex]

Now, substitute 6 as [tex]x_1[/tex] and 3 as [tex]y_1[/tex].

[tex]y-3=7(x-6)[/tex]

Put the numbers in ascending order:
-6, 19, 4, -22, 9​

Answers

Answer:

-22, -6, 4, 9, 19

Step-by-step explanation:

hope this helps

| 2n+2g = 5
3x + 3y = 7
How many solutions does the system of equations above have?

Answers

Answer:

The following equation has no / zero solution.

Step-by-step explanation:

The slope of both the equations is proportional which means that the lines are parallel to each other. Thus, the given equation has no solutions.

Is 6.32332333... a rational or irrational number? a Choose the correct answer below. O rational number O irrational number​

Answers

Answer:

Irrational number because it cannot be written in fraction form a/b where b is not supposed to be 0



1. What is the value of x that satisfies the equation? Must show all proper work/steps!

32^2x = 16^2x+8

Student's Work

Student's Answer

A. x = 4

B. x =- 4

C. x = 16

D. x = 1

Please explain all steps

Answers

[tex] {32}^{2x} = 16 ^{2x + 8} \\ = > {2}^{5(2x)} = {2}^{4(2x + 8)} \\ = > {2}^{10x} = {2}^{8x + 32} \\ = > 10x = 8x + 32 \\ = > 10x - 8x = 32 \\ = > 2x = 32 \\ = > x = \frac{32}{2} \\ = > x = 16[/tex]

Answer:

x = 16

Hope you could get an idea from here.

Doubt clarification - use comment section.

Which of the following is a correct cosine ratio for the figure?
(refer to the picture below)
A) C = 13∕12
B) C = 5∕13
C) C = 5∕12
D) C = 12∕13

Answers

Answer:

D

Step-by-step explanation:

Cosine is adjacent / hypotenuse, so 12/13

A box is 36 inches long,18 inches wide, and 6 inches deep. How many cubic feet are in the box?

Answers

Answer:

3,888 ft³

Step-by-step explanation:

Multiply the dimensions together.

[tex](36)(18)(6)=3888[/tex]

Therefore, the box is 3,888 ft³.

The volume of the box in feet given its dimensions is 2 1/4 feet³.

What is the volume of the box?

The volume of the box can be determined by multiplying the length, width and height of the box with each other.

Before the volume can be determined, the dimensions have to be converted from inches to feet.

1 inch - 1/12 feet

Length = 36 / 12 = 3 feet Width = 18 / 12  = 3/2 feet Height = 6/12 = 1/2 feet

Volume = 3 x 3/2 x 1/2 = 9/4 = 2 1/4 feet³

To learn more about the volume of a cuboid, please check: https://brainly.com/question/26406747

#SPJ2

A Biology test has 20 questions and is worth a total of 100 points. The test
consists of True/False questions worth 2 points each and multiple choice questions
worth 7 points each. How many of the test questions are multiple choice and how
many of the test questions are True/ False?.
# of true/false questions =
# of multiple choice questions
PLEASE HELP ME I WILL GIVE BRAINLY

Answers

Answer:

12 multiple choice and 8 True/False

Step-by-step explanation:

To do this we set up a system of equations. Let x represent the True/Fale questions and y represent the multiple-choice questions. Here is a system we can use:

x + y = 20

2x + 7y = 100

We can solve this by using elimination. To do this we multiply one equation by a number, and add them together. If we multiply the first equation by -2, the "x"s will, when added together, cancel out so we can solve for y.

-2(x + y = 20)

-2x - 2y = -40

Now add them together

5y = 60

Solve for y.

y = 12

This means there are 12 multiple choice questions. 20 - 12 is 8 True/False questions.

Hope this helps and have a great day! :D

Answer:

8 True/False and 12 Multiple Choice

Step-by-step explanation:

x+y=20  ...1

2x+7y=100   ...2

Now you can multiply 2 on 1

2x+2y=40

2x+7y=100

Subtract:

-5y=-60

Divide -5 on both sides:

y=12

Substitute y with 12

x+12=20

Subtract 12 on both sides:

x=8

So there are 8 True/False and 12 Multiple Choice

Hope this Helps!

Answer helped by: azailiaskoglund

order the expression from least to greatest

Answers

Answer:

So it would be 4, 11, 20

Step-by-step explanation:

[tex]11^1 = 11[/tex]

[tex]2^2 * 5 = 20[/tex]

[tex]8^2-60 =4[/tex]

Which expression is undefined?

Answers

Answer:

D: [tex]\frac{3}{(6-6)}[/tex]

Step-by-step explanation:

Option A equates to [tex]-\frac{0}{2}=0[/tex]

Option B equates to [tex]\frac{(-4+0)}{8}=\frac{-4}{8}=-\frac{1}{2}[/tex]

Option C equates to [tex]0\div11 =0[/tex]

Option D equates to [tex]\frac{3}{(6-6)}=\frac{3}{0}[/tex] which cannot be defined as division by 0 is impossible

Question
A triangle with area 40 square inches has a height that is four less than six times the width. Find the width and height of the
triangle

Answers

Answer:

width is 4

height is 20

Step-by-step explanation:

Area=½ width × height

let the width be x

height will be 6x - 4

40 = ½ × x × (6x - 4)

40 = 2/2 × 3x² - 2x

40 = 3x² - 2x

3x² - 2x - 40 = 0

3x² -12x + 10x - 40 = 0

3x(x-4) + 10(x-4) = 0

(3x + 10)(x - 4) = 0

x = -10/3 or 4

dimension cannot be negative

x is 4

6x-4= 6(4) - 4

24 - 4

20

Convert 56 grams to 2 ounces

Answers

Answer:

its 2 ounces. if you look it up it would tell you

What is 5x + 12 < 2 ?

Answers

Answer:

x < -2

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Algebra I

Equality Properties

Multiplication Property of Equality Division Property of Equality Addition Property of Equality Subtraction Property of Equality

Terms/Coefficients

Step-by-step explanation:

Step 1: Define

Identify.

5x + 12 < 2

Step 2: Solve for x

[Subtraction Property of Equality] Subtract 12 on both sides:                       5x < -10[Division Property of Equality] Divide 5 on both sides:                                 x < -2

Answer:

x < - 2

Step-by-step explanation:

5x + 12 < 2 ( subtract 12 from both sides )

5x < - 10 ( divide both sides by 5 )

x < - 2

factor x[tex]x^{2} -81[/tex]

Answers

Step-by-step explanation:

[tex]x^2-81=x^2-9^2=(x-9)(x+9)\\\\\text{Used}\\\\a^2-b^2=(a-b)(a+b)[/tex]

Ok done. Thank to me :>

what is 2*6 i need help

Answers

Its 12 for answer

Step-by-step explanation:

2×6=12

HELP ASAP
The temperature was -1°F at noon and dropped to -14°F by the evening.

What was the change in temperature?

13°F
-13°F
-15°F
15°F

Answers

ΔT = T(final)-T(initial)

ΔT= -14 - (-1)
= -14 + 1
= -13F

Answer:

The change in temperature is -13°F.

Step-by-step explanation:

The change in temperature is,

→ -1 + x = -14

→ x = -14 + 1

→ [ x = -13 ]

Therefore, -13°F is the change.

88888*88888 help me please

Answers

88888*88888 7901076544

18/5=t/4 what does t=

Answers

Answer:

72/5

Step-by-step explanation:

18/5 x4 = t/4 x4

(18x4)/5 = t

t = 72/5

100 POINTS
Please HELP I THINK ITS THE ANSWER I CLICKED THAT HAS A BLUE CIRCLE BUT I dont know

Answers

You’re correct!
a is equal to three less than twice b

Hope this helps!
Brainliest and a like is much appreciated!

Answer:

Option D

Step-by-step explanation:

Twice b means b is multiplied by 2 or 2b3 less than twice b means it's subtracted or 2b-3.

The expression is a=2b-3

PLEASE HELLPPPPPP IDONTKNOWTHISSS

Solve this system of equations using the Substitution method. Don't forget to write your final answer as a coordinate point. You must show all your work.

3x + y = -2

y = 2x + 3

Answers

Solution :

= 3x+y=-2

= Linear equations with two variables have multiple infinite solutions.

= Assuming x=0

then y=-2

= Assuming x=1

then y=-2-3

= y=-5

= Assuming x=2

then y=-2-6

= y=-8

Writing them as coordinate points -

(0,-2),(1,-5),(2,-8)...and so on.

__________________________.

= y=2x+3

Assuming x=0

then y=3

Assuming x=1

then y=2+3

= y=5

Assuming x=2

then y=4+3

= y=7

Writing them as coordinate points -

(0,3),(1,5),(2,7)...and so on.

Answer:

Point Form:

( − 1 , 1 )

Equation Form:

x = − 1 , y = 1

Step-by-step explanation: there you go

Choose a way to solve.
Write or draw to explain.
2. Greg has Il shirts.
3 have long sleeves.
The rest have short sleeves.
How many short-sleeve
shirts does Greg have?
Help please! Thank you in advance!!

Answers

Answer:

8 short sleeve shirts

Step-by-step explanation:

Subtract the total amount of of shirts by the number of shirts with long sleeves to find your answer.

Help help math math math

Answers

Answer:

y = 3x + 4

x=? (m) , and 'm' is how steep the slope is , which is at 3 , located on the X-axis. The blank is 'b' which is where the point intercepts the Y-axis , which is at 4 , located on the Y-axis.

(i think this is right im not sure tho)

Answer:

3x+1

Step-by-step explanation:

3 is the slope. 3 times x is 3 because x is one. 3+1=4 4 is y

At the airport, each piece of luggage to be checked in must not weigh more than 50
pounds.
Use w to represent the weight (in pounds) of a piece of luggage that can be checked in.

Answers

Answer:

w [tex]\leq[/tex] 50

Step-by-step explanation:

Through what angle does the minute hand of a clock turn in 45 minutes?

Answers

Answer:

2700

Step-by-step explanation:

A clock is a circle, and a circle always contains 360 degrees. Since there are 60 minutes on a clock, each minute mark is 6 degrees.

so

45 * 6 =

2700

⦁ Simplify: –3|–2| + 4|–5|
show work

Answers

Answer:

-3|-2|+4|-5|=14

Step-by-step explanation:

3| -2 =6

4| -5| =20

= -6+20

Simplify -

14

Thank You! I hope I could make your day just a little bit better!


Assume that all letters in the following equation represent positive numbers.

Answers

Answer:

None of the suggested answers

the ordered pair (2, - 3) has a solution to which of the following inequalities?

Answers

You forget to upload a picture
But you can just substitute x by 2 Andy by -3 if the equation is true then it is a solution

heyyy can have halppppp

Answers

Answer:

ang hirap naman plss answee

Find the area of the triangle

Please help me - I don't get how to do this.

Please show your work - I really need to understand this

Answers

Answer:

Step-by-step explanation:

1. Pythagorean theorem: a^2+b^2=c^2

Note that the hypotenuse is 11 (for the second right triangle).

Find the length of the dotted line by doing 7^2+b^2=11^2

49+b^2=121, b=[tex]\sqrt{72\\}[/tex].

Now you can the area of the second right triangle: ([tex]\sqrt{72\\}[/tex](7))/2=29.7.

Find the length of the first right triangle:

Note that 9 is the hypotenuse; ([tex]\sqrt{72\\}[/tex])^2+b^2=9^2

=72+b^2=81

b=3.

([tex]\sqrt{72}[/tex])(3))/2=12.7

The length of a pool is twice its width. What is the ratio of the length to the width of the pool?

Answers

Answer:

2:1 OR as a fraction, 2/1

Step-by-step explanation:

We don't know the actual length or width of this pool, like we don't know a number, as in exactly how many feet or meters long or wide this pool is. For this question, we don't need to know. "Twice" means 2 times. So if we consider the width (which we don't know) and call it w, then the length, (which we also don't know) which is two times as long, would be 2w

Width = w

Length = 2w

Ratio of Length to Width is

2w:w or as a fraction 2w/w

This can be simplified to

2:1 or as a fraction 2/1

Other Questions
sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. Steam Workshop Downloader