A. Joshua puts $8,765 in a
10-year 5.28% savings
certificate in which interest is
compounded quarterly. How
much total interest has he
earned at the end of the ...
a) second year?
b) fourth year?
c) seventh year?
d) tenth year?

A. Joshua Puts $8,765 In A10-year 5.28% Savingscertificate In Which Interest Iscompounded Quarterly.

Answers

Answer 1
C. Seventh year because that’s how much he will earn from the interest
Answer 2

The amount at the end of the second year is $9,734.49.

The amount at the end of the fourth year is $10,811.22.

The amount at the end of the seventh year is $12,653.68.

The amount at the end of the tenth year is $14,810.14.

What is compound interest?

It is the interest we earned on the interest.

The formula for the amount earned with compound interest after n years is given as:

A = P [tex](1 + r/n)^{nt}[/tex]

P = principal

R = rate

t = time in years

n = number of times compounded in a year.

We have,

P = $8765

r = 5.28%

n = 4 (quarterly)

Amount after 2 years.

A = 8765 [tex](1 + 0.0131)^2[/tex]

A = $9,734.49

Amount after 4 years.

A = 8765 [tex](1 + 0.0131)^4[/tex]

A = $10,811.22

Amount after 7 years.

A = 8765 [tex](1 + 0.0131)^7[/tex]

A = $12,653.68

Amount after 10 years.

A = 8765 [tex](1 + 0.0131)^{10}[/tex]

A = $14,810.14

Thus,

The amount at the end of the second, fourth, seventh, and tenth year is given above.

Learn more about compound interest here:

https://brainly.com/question/13155407

#SPJ2


Related Questions

What do u get after dividing the sum of 352 and 698 by 5

Answers

Answer:

the answer to the question is 210

Solve the compound inequality and graph the solutions.
-10<2x – 10 <30
The solutions to the compound inequality are

Answers

Answer:

0 ≤  x ≤ 20.

Step-by-step explanation:

-10≤2x – 10 ≤30

2x - 10 ≤ 30

2x ≤  40

x ≤ 20.

2x - 10  ≥ -10

2x ≥  0

x ≥ 0.

For compund inequalities you will have to separate both sides of the inequality into different equations so you can later plug it in.

For Example:

-10 ≤2x-10 Would be 0 ≤x

Add 10 on both sides, end up with 0≤2x then divide by 2 on both sides and end up with 0≤x

2x-10 ≤30 Would be x ≤20

Add 10 on both sides end up with 2x≤40 divide by 2 on both sides and end up with x≤20

So the answer would be 0 ≤ x ≤  20

y=
4
5
x+1
y=

3
5
x–6

Answers

Answer:

   

Step-by-step explanation:

Answer:

So, yea i cant get you an exact answer but... i can tell you howto solve it.

Step-by-step explanation:

IN this case you would need to rewrite it so it is on the left side!

Bye friend! :)

you have also wasted your time by going down heere so, YOUR FAULT

4. Jeremy is starting a juice-bar business. The cost to start the business is $32,000 and the
monthly costs are $4,000. He has been earning $5,600 every month in revenue. In how many
months will Jeremy's business break-even and earn a profit?

Answers

Answer:

Step-by-step explanation: Ok so the important thing is to figure out how much he makes each month. if he earns 5,600 but the cost are 4,000 he makes 1,600 every month. To figure out how many months it will take we divide 32,000 by 1,600 to get 20. that is when he breaks even, 20 months. To make a profit it will be 21 months.

1. Classify the following polynomials as monomial, binomial trinomial and polynomial:
i) 2x + y

Answers

Answer:

binomial

Step-by-step explanation:

a monomial has 1 term

a binomial has 2 terms

a trinomial has 3 terms

2x + y has 2 terms and so is a binomial

Answer is binomial step-by-step-equation

8 (x minus 2) = 64. 8 x minus 16 = 64. 8 x = 80. x = 10.

Which property is used in the last step to find that x = 10?

Answers

Answer:

Inverse Property of Multiplication

Step-by-step explanation:

Inverse Property of Multiplication is when you do inverse operations to get rid of a multiplied number (if that makes any sense). to solve 8x = 80 you do the inverse of multiplying by 8 (divide both sides of the equal sign by 8) to get x=10.

As shown in the illustration, Alexa had a negative balance in her checkdng account before depositing a $47.00 check. What is the new balance of Alexa's checking account?​

Answers

Answer:jjjjjjjjjjjjjjjjjjjj

jjjjjjjjjjjjjjjjjjjjjjjjjj

jjjjjjjjjjjj

jjjjjjjj

jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

The forecast for Monday shows an 80% chance of rain. What is the probability that it will not rain on Monday?

Answers

Answer:

20%

Step-by-step explanation:

100%-80%=20%

....... .

20% js use multiplication ( 100-20 = 20 )

How many solutions does this system have?

y=2/3x + 32x - 3y = -9

A. One Solution

B. Two Solutions

C. No Solutions

D. Infinitely Many Solutions

Answers

Answer:

No solutions since they are two variables and it supposed to be solved simultaneously

estimate the line of best fit using two points on the line

Answers

Answer: The answer is Y = - 2/3x + 12

Step-by-step explanation: The line goes through point A

Answer:

[tex]y=-8x+80[/tex]

Step-by-step explanation:

[tex]Slope=\frac{y_2-y_1}{x_2-x_1}=\frac{32-64}{6-2}=\frac{-32}{4}=-8[/tex]

[tex]y=mx+b[/tex]

[tex]y=-8x+b[/tex]

[tex]64=-8(2)+b[/tex]

[tex]64=-16+b[/tex]

[tex]80=b[/tex]

Therefore, the estimated line of best fit is [tex]y=-8x+80[/tex]

X/2 = Y/3 = Z/4. prove that :2X-Y+5Z / 3Y-X =3. note :: (/) is for a fraction aka divide. help pls I've been stuck on it for a few days​

Answers

The given equation

x/2 = y/3 = z/4

can be broken into three separate equations which I'll call equations (A), (B) and (C)

x/2 = y/3 ..... equation (A)y/3 = z/4 .... equation (B)x/2 = z/4 .... equation (C)

We'll start off solving for z in equation (C)

x/2 = z/4

4x = 2z ... cross multiply

2z = 4x

z = 4x/2 ... divide both sides by 2

z = 2x

Now let's solve for y in equation (A)

x/2 = y/3

3x = 2y

2y = 3x

y = 3x/2

y = (3/2)x

y = 1.5x

The results of z = 2x and y = 1.5x both have the right hand sides in terms of x. This will allow us to replace the variables y and z with something in terms of x, which means we'll have some overall expression with x only. The idea is that expression should simplify to 3 if we played our cards right.

We won't be using equation (B) at all.

---------------------

The key takeaway from the last section is that

z = 2xy = 1.5x

Let's plug those items into the expression (2x-y+5z)/(3y-x) to get the following:

(2x-y+5z)/(3y-x)

(2x-y+5(2x))/(3y-x) ..... plug in z = 2x

(2x-y+10x)/(3y-x)

(12x-y)/(3y-x)

(12x-1.5x)/(3(1.5x)-x) .... plug in y = 1.5x

(12x-1.5x)/(4.5x-x)

(10.5x)/(3.5x)

(10.5)/(3.5)

3

We've shown that plugging z = 2x and y = 1.5x into the expression above simplifies to 3. Therefore, the equation (2x-y+5z)/(3y-x) = 3 is true when x/2 = y/3 = z/4. This concludes the proof.

I cannot figure this out. Any help would be appreciated.

Answers

so you are finding M
90+x+15+3x+15=180
4x=60
X = 15
LMN = 15+15
LMN = 30
hopefully this is correct :)

The quadrilateral with the following vertices is a ______. (-6, -2), (4, -2), (2, -5), (-7, -5)

Answers

Answer:

rectangle

Step-by-step explanation:

u can use a graph paper

Can you prove that 4+2=5+1 is true without solving both sides of equation?

Answers

Answer:

Here you go...

Step-by-step explanation:

You have 4, and you have 5.

You have 4+2 and you have 5+1

So, you take a 1 from the 2 in the first problem, which gives u 4+1 that equals 5.

Therefore, if u put the first equation in a simpler form then you get 5+1 with the other equation. So it would look like 5+1=5+1.

FURTHERMORE, 4+2= 5+1 (because you simplify 2 into a 1).

So. 5+1 equals 5+1. (which is common sense... 5+1= 6.)

Find the roots 3x^3-13x^2-26x-24

Thank you

Answers

Answer:

31781715561888155919761999

Which numbers are irrational numbers?
Select each correct answer.

Answers

the correct answer is B

Answer

Well pi is an irrational number because it can't be simplified into a fraction. And from what I can see neither can the sqaure root of 10/49. So I believe it would be both of them. But if there is only one answer than i'm not sure sorry. But it also says each so maybe there is more than one answer.

Step-by-step explanation:

Emika has a monthly budget for her cell phone bill.
Last month she spent 120% of her budget, and the bill
was $60.
What is Emika's monthly budget?

Answers

Emika's monthly budget is $60.

A percentage can be described as the fraction of a number multiplied by 100. The sign used to represent percentages is %.

Let Emika's cell phone bill budget be represented with x.

In order to determine his monthly budget, divide $60 by 120%

x = $60 / 120%

x = $60 / 1.20

x = $50

To learn more about percentages, please check: https://brainly.com/question/25764815

Use Pythagorean theorem to find right triangle si
Find the value of x in the triangle shown below.
C
9
3

Answers

9.5 i believe, 9 x 9 = 81
3 x 3 = 9
81 + 9 = 90
square root of 90 = 9.5

The length of x is 3√10 units.

What is Pythagoras Theorem?

The Pythagorean theorem, sometimes known as Pythagoras' theorem, is a basic relationship between a right triangle's three sides in Euclidean geometry. According to this rule, the areas of the squares on the other two sides add up to the area of the square whose side is the hypotenuse, or the side across from the right angle. This theorem can be expressed as the Pythagorean equation, which is an equation connecting the lengths of the sides a, b, and the hypotenuse c. Pythagoras, a Greek philosopher who was born around 570 BC, is remembered by the theorem's name. The theorem has likely been proved the most times of any mathematical theorem using a variety of techniques.

As per the given data:

Perpendicular = 9 units

Base = 3 units

Using Pythagoras theorem to find x (hypotenuse):

[tex]x^2 = 9^2 + 3^2\\x^2 = 81 + 9\\x^2 = 90\\x = \sqrt{90}\\x = \sqrt{9\times10}\\x = 3\sqrt{10}[/tex]units

Hence, the length of x is 3√10 units.

To learn more about Pythagoras theorem, click:

brainly.com/question/343682

#SPJ7

can someone help me. these are due tonight.

Answers

Answer:

x = 4

Step-by-step explanation:

3x-4 = 8

3x = 12

x = 4

good luck

Answer:

x = 4

Step-by-step explanation:

3x - 4 = 8

3x = 8 + 4

3x = 12

x = 4

Part A: Find the LCM of 7 and 8. Show your work. (3 points)

Part B: Find the GCF of 54 and 81. Show your work. (3 points)

Part C: Using the GCF you found in Part B, rewrite 54 + 81 as an expression of two factors. One factor is the GCF and the other is the sum of two numbers that do not have a common factor. Show and explain your work.

Answers

Answer:

Part A:

LCM of 7 and 8 is 56.

7*8 = 56

-------------------------------------

Part B:

GCF of 54 and 81 is 27.

54: 1, 2, 3, 6, 9, 18, 27, 54.

81: 1, 3, 9, 27, 81.

-------------------------------------

Part C:

GCF of 54 and 81 is 27.

54 / 27 = 2

81 / 27 = 3

Final expression: 27(2 + 3)

Answer:

Part A: 56

Work:

7: 7, 14, 21, 28, 35, 42, 49, 56

8: 8, 16, 24, 32, 40, 48, 56, 64

Part B: 27

Work:

54: 54, 27, 9, 3, 1

81: 81, 27, 9, 3, 1

Part C: 27(2+3)

Work:

27×2 = 54    

27×3 = 81

(27×2)+(27×3) = 54+81

(27×2)+(27×3)=27(2+3)

Explaining work:

First you find the numbers that multiply the GCF by to get the product (for 54 it is 2 and for 81 it is 3). Then you replace the the products with the equations (27×2) for 54 and (27×3) for 81 to get (27×2)+(27×3). Then simplify to get 27(2+3).

(2x + 23), (8x + 2) and (20x – 52) are three consecutive terms of an arithmetic sequence.
Prove that the common difference of the sequence is 12

Answers

Step-by-step explanation:

Given (2x + 23), (8x + 2) and (20x - 52) are three consecutive terms of an arithmetic sequence.

(8x + 2) - (2x + 23) = (20x - 52) - (8x + 2)

or, 6x - 21 = 12x - 54

or, 12x - 6x = - 21 + 54 = 33

or, 6x = 33

or, 2x = 11

∴ x = 11/2

∴2x + 23 = 2 × 11/2 + 23 = 34

8x + 2 = 8 × 11/2 + 2 = 46 and

20x - 52 = 20 × 11/2 - 52 = 110 - 52 = 58

34, 46 and 58 are three consecutive terms of an arithmetic sequence.

∴ Common difference(d) = 46 - 34 = 58 - 46 = 12, it is proved.

Hence, the common difference of the sequence is 12.

Can someone please help me with this one? :D ty!

Answers

2,000 Sorry That Was I Know #carryonlearning

A veterinarian is trying to decide which website to use for her office. She gathers information on the customer ratings for each website and constructs a boxplot of each. There are the same number of ratings for each website. The results are shown in the following boxplots:

Based on these boxplots, which of the following is true?

The interquartile range for website A is greater than for website B.
The range for website B is greater than for website A.
The median ratings for the two websites are the same.
The interquartile ranges for the two websites are the same.

NO LINKS TO ANSWERS PLEASE ONLY RESPONSES BELOW QUESTION!!!

Answers

Based on the boxplots, it can be stated that the interquartile ranges for the two websites are the same.

This is so for the following reasons:

Website A has a range that goes between 10 and 65, that is, 55 points (65 - 10). Website B has a range that goes between 20 and 75, whose difference is also 55 (75 - 20).

Learn more about maths in https://brainly.com/question/25811665

CAN SOME ONE PLEASE ANSWER THIS RIGHT THANK YOU
m > 17.2
What word sentence represents this inequality?

1: A number is less than 17.2
2: A number is greater than 17.2
3: A number is at most 17.2

Answers

Answer:

2:A number is greater than 17.2

Step-by-step explanation:

the ">" in the inequality represents is greater

so the m> means m is greater than... and then the 17.2 means m is greater than 17.2. The way I learnt it was to imagine the ">" sign is like a crocodile, it wants the bigger number. So the ">" being towards the "m" shows that m is the bigger number.

Answer:

2

Step-by-step explanation:

in a right triangular prism the area of the Triangular base is 12 square centimeters the height of the prism is 7 cm what is the volume of the prism?

A) 60cm³

B) 84cm³

C) 72cm³

D) 98cm³​

Answers

Answer:

84cm cubic.

Step-by-step explanation:

That is how it is done.Hope it will help.

A copy machine makes 32 copies per minute. How long does it take to make 144 copies?

?????

Answers

4mins and 30seconds is the correct answer

Zero is a solution for which inequality?
4.1m > -16.4
4.1m > 16.4
-4.1m > 16.4
4.1m < -16.4

Answers

Since 0 is greater than -4 in the expression 4.1m >-16.4, hence zero is a solution to this inequality

Given the following inequality, we are to check which of them has zero as a solution.

For the expression

4.1m >-16.4

m > -16.4/4.1

m > -4

Since 0 is greater than -4, hence zero is a solution to this inequality

Learn more on inequality here: https://brainly.com/question/24372553

Determine the equation of the line.

Answers

Answer:

Y = 5x - 10

Step-by-step:

Leave a brainliest if this helped!

helppppppppp[pppppp[pppppppppp

Answers

Answer:A

Step-by-step explanation:i mean that sound logiclity correct

help pls!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Name:

Grade & Section:

Date Submitted: 12/14/2021

Advent: Use it

Christmas: Open gifts under the tree left by Santa

Ordinary Time:

Lent: Celebrate Jesus.

Paschal Triduum: The Proper day to Celebrate Jesus

Easter: It is a Holiday where you celebrate a bunny and get candy.

Step-by-step explanation:

So is what you do here is you enter your Name, Grade & Section, and Date which i've already given you. So your assignment is about how you will participate in the seasonal activity. So Advent looks like it would be a Advent Calendar.

Christmas You wanna open gifts

Now I left Ordinary Time blank because you need to put what time you would regularly open gifts or if you do not celebrate Christmas put what time you'd like to open gifts at.

Lent: is where you celebrate Jesus and what he did on his time being on Earth.

Paschal Triduum is basically the same as Lent but it is the proper day you celebrate Jesus Which starts April 13 & Ends Saturday, April 16

Easter: Is where you usually get candy but it is in a hunt form

Other Questions
PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates