A model for how the solar system formed must explain
observations and reasoning. Identify each statement as
an example of an observation or reasoning. If a statement
is false or invalid, identify it as such.
a. Most of the mass of the solar system is in the sun.
b. The sun is composed primarily of hydrogen and
helium.
c. The sun formed more than 13.8 billion years ago when
the universe formed.
d. Most objects in the solar system orbit the sun in the
same direction.
e. If most of the mass of the solar system is in the sun
and the sun is mostly hydrogen and helium, then the
solar system must primarily be hydrogen and helium.

Answers

Answer 1

Answer:

The correct answer would be -

a. observation

b. observation

c. invalid

d. observation

e. reasoning

Explanation:

Any observation or statement form or generated by the understanding and nothing any event. The first statement is formed by observing the sun and the rest of the solar system and comparing its mass. The second and fourth statement is also observations made on fact or noticing the.

The fifth statement is reasoning as it deriving something from logic and fact. The third statement is invalid as the universe made before the sun.


Related Questions

A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.

Answers

Answer:

Photon, light dependent reaction of photosynthesis

Explanation:

Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.

There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.

In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.

Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

4) After a horrible car wreck, Jamie had a broken ankle, a few minor cuts, scratches, and a
large bruise across her chest from the seatbelt. While at the hospital, they kept checking her left
lung because it kept collapsing.
What systems are affected?
Why?

Answers

I think the respiratory bc of her lungs collapsing or maybe the cardiac one bc her oxygen could be blocked

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Answers

Answer:

Reproduction

Explanation:

Answer:

Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

During which phase of mitosis do the chromosomes pull away from the middle of the cell?

Answers

In Anaphase of mitosis chromosomes pull away from the middle of the cell.

During this period the replicated chromosomes are split and moved to the opposite poles of the cells.

What is mitosis?

It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.

What are chromosomes?

It is along DNA molecule with part or all of the genetic material of an organisms.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ2

In what ways is the composition of the sun different from the Earth? Choose all that apply.
The Sun does not have continents.
O The Sun has a thick, solid core.
O The Sun does not have a solid surface
The Sun does not have a solid core.
The Sun has continents known as plasma zones.

Answers

Answer:

1,3,4

that's my answerrrr

According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.

Answers

Answer:

the hard work he went through

The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!

Answers

Answer:

The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell

Explanation:

Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.

What is Plasma Membrane?

Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.

The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.

The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.

Therefore, correct option is A.

Learn more about Plasma membrane here:

https://brainly.com/question/24588191

#SPJ5

List some animals affected by soda cans and plastic bottles

Answers

Answer:

turtles, fishes, birds, whales, cats, dogs, really any animal can be affected

Explanation:

(any animal in the ocean) mark as brainliest plz

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

A student states that petrification occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution. What is wrong with this statement?

A.
Permineralization occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution.
B.
Petrification occurs when once-living tissues are replaced by minerals, preserving the organism's structure.
C.
Both A and B describe errors in the statement.
D.
Nothing, this statement is correct as is.

Answers

Answer:

C. Both A and B describe errors in the statement.

Explanation:

In fossilization i.e formation of fossils, two terms are used as follows: permineralization and petrification.

- Permineralization is a process whereby the pore spaces of an organism's remains are filled with mineral matter that precipitates from lake and ocean solutions.

- On the contrary, petrifaction or petrification is the process whereby a once-living tissue (matter) are REPLACED by minerals, hence, preserving the organism's structure by turning it into a stone (petros).

According to this question, the student mixed up their definitions by giving the definition of permineralization instead, however, options A and B have described the errors associated with the statement.

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

What is mass transport across the cell membrane

Answers

Diffusion through a permeable membrane moves a substance from an area of high concentration (extracellular fluid, in this case) down its concentration gradient (into the cytoplasm). The passive forms of transport, diffusion and osmosis, move materials of small molecular weight across membranes.

⚠️Second time posting this⚠️
the factors that control genes are called "alleles".
True
or
false

Answers

Answer

Explanation:

I think its true

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?

Answers

Answer:

Due to splitting of lands.

Explanation:

These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

PLEASEE help me answer this question!??

Answers

Answer:

a or b.

Explanation:

it can be in ts regular form solid or it just formed like a liquid

Answer:

B. liquid I think.

Explanation:

or solid bc coal is a solid.

thats all i got.

how does water pollution harm water ecosystems?

Answers

Answer:

the animals die due to the chemicals and stuff in the water

Explanation:

Animals that live in a water ecosystem could get poisoned and die of all the pollution in the water, and all the trash that enters the waters.

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False

Answers

Answer:

true

Explanation:

Answer:

False.

Explanation:

Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.

Have a great day! (:

Which is required for sexual reproduction

Answers

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.

what would be the most beneficial towards maintaining equilibrium in an ecosystem over a long period of time?
a)organisms imported by humans from other environments
b)a sudden change in climate
c) a diversity of organisms
d)predators eliminated from the food chains

Answers

Answer:

c) a diversity of organisms

Explanation:

Biodiversity refers to the number of different species of animals,plants and microorganisms.Biodiversity increases ecological stability in changing environments.Biodiversity reduces competition ,provide more food resources,increases ecosystem productivity etc.

What are the locations and end products for the processes of transcription and
translation?

Answers

Transcription is the synthesis of RNA from DNA. Occurs in the nucleus. Translation is the synthesis of a protein from RNA. Occurs in the cytoplasm.

The cytoplasm is the site of translation, the next process that converts a gene into a protein. In order to “read” the sequence of mRNA nucleotides, the ribosome, a specialized complex, interacts with the messenger RNA.

What is role of gene expression in an organism?

It serves as both a volume control that raises or lowers the level of proteins produced, and an on/off switch to regulate when proteins are created.

Because a particular protein can only be made when its gene is turned on, gene expression is significant.

But the process of turning a gene into a protein involves numerous steps, and one of these phases—the production of proteins—is essential for the gene expression pathway that can be altered in cancer.

Therefore, transcription occur at nucleus and translation take place in cytoplasm.

Learn more about gene expression here:

https://brainly.com/question/14182257

#SPJ6

what is the atmosphere for gas essential for animal life?

Answers

Answer: oxygen

Explanation:

What are the advantages and disadvantages of a honey bees sexual reproduction

Answers

Answer:I just learned this.

Explanation: The Advantage is that they have plant pollination and honey.

which describes a eukaryotic cell,but not a prokaryotic cell?

Answers

Answer is c it is surrounded by cell membrane
Other Questions
In a federal system there are two levels of government-the president andCongressTrue or False Pls help me I don't understand this..... I will mark you as brainliest... the first one who answers What is the speed of an object that travels 80 meters in 2 seconds? a160 m/2 b0.04 m/s c40 m/s 6 lots of 3 is 6 more than 5 lots of 3 The physician orders penicillin G procaine 400,000 units IM for syphilis. The medication is supplied in 1,200,000 units/2 mL. How many milliliters will the nurse administer? please help meThe statement below is from the Magna Carta written in 1215."To no one will we sell, o no one will we refuse or delay, right or justice."Which political principle justifies this statement?The right to trial protects political institutions.The rule of law guarantees fair legal treatment.Checks and balances prevent tyranny in government.Separation of powers permits shared government authority. What is the slope of a line given by the equation 2Y-4X+8=0? what are some similarities between polar and nonpolar molecules Match the stages of the desktop publishing process with the corresponding actions. (Design, Setup, Prepress, Printing, and Content)enter text and imagescreate an initial outline or draft of the artwork choose a specific document template with appropriate DTP softwareperform the tasks to get the artwork ready for printingchoose either to print or publish the product online Should stores sell clothing that some might think is offensive? Why or Why not WHat is 100 digits of pi? what percent of the sun's energy is used by the living organism on eartha. 1% b. 10% c. 20% d. 35% e. 50% Please help!!Either the gallery director or the artists (is, are) at the center of that crowd. Simplify each exponential expression using the properties of exponent and match it to the correct answer How does the U.S Constitution limit the powers of the national and state government? The Jackson-Timberlake Wardrobe Co. just paid a dividend of $1.52 per share on its stock. The dividends are expected to grow at a constant rate of 7 percent per year indefinitely.Required:a. If investors require a 11 percent return on The Jackson-Timberlake Wardrobe Co. stock, what is the current price?b. What will the price be in 8 years? PLEASEE HELP ME BRO !!!!!Adrian Miller is accused of sneaking lnto the school to try to change hisgrades. Which plece of evidence from source 2 most conflcts with Alma'sclaim that she saw Adrian entering the school?SOURCE 1: Testimony of Alma Fernandez Thls time of year, I usuallycome to school on Saturday between 3:00 p.m. and 7:00 p.m. to helpCoach Rawls sort cases for the debate team, because the Nebraskastate debate tournament is coming up soon. He asked me to takesome files over to the administration bulding, and on my way I sawAdrian sneaking in.It was too dark out to see his face, but I recognizedhis hoodie because it has tiger stripes on it.SOURCE 2: Report on Adrian Mllers movements: Adian clocked intowork at Chuck's Quick Grille at 10:59 a.m. The cooks reported himmissing at around 12:30 p.m., and the manager noticed that his carwas missing from the parking lot at that time, though his tiger-stripedsweatshirt was still hanging in the break room. A local traffic cameraspotted his car moving up Grape Avenue at 1:07 p.m. Adrlan returnedto work at a 2:40 p.m, and several witnesses noted that he stayedthere until closing time at 9:00 p.m. What is 700,000+9,000+60+7 in Standard form According to the narrator of a visit to Europe, which belief did British hold about Indian women? Evaluate the function:f(x)=x24x, find f(3) Steam Workshop Downloader