Benjamin's moped will need to be replaced soon. Which choice would be
the worst for him to make that would disrupt his other financial goals?

Answers

Answer 1

Benjamin should avoid making any financial decisions that would disrupt his other financial goals. He should aim to find a cost-effective and efficient solution to replace his moped without overspending or incurring debt

However, it is important that he does not make any choices that would disrupt his other financial goals. One of the worst choices he could make would be to take out a high-interest loan or put the purchase on a credit card with a high-interest rate. This decision would lead to him incurring more debt, which could hinder his other financial goals such as saving for a down payment on a house or investing in his retirement fund.

Another bad choice would be to purchase an expensive and high-end moped that is beyond his budget. This decision would result in him overspending and possibly accumulating debt, which could hinder his other financial goals. It is important that Benjamin sets a budget and looks for a cost-effective and efficient moped that fits his needs and budget.

Lastly, Benjamin should avoid tapping into his emergency fund or dipping into his savings account to purchase the moped. He should aim to keep his emergency fund intact and continue contributing to his savings accounts to ensure he can meet his other financial goals.

For more such questions on  financial decisions visit:

https://brainly.com/question/1861850

#SPJ11


Related Questions

What is the safest action you could take if you receive a resume on LinkedIn from a candidate who is interested in a position at your organization

Answers

If you receive a resume on Lin-kedIn from a candidate who would be interested in a position at your company, save the attachment immediately to their candidate profile.

This enables you to study the candidate's profile and recruiting activity before determining whether to pursue the candidate further. When uploading your resume online, you should also choose trusted sources that have a direct link to legitimate firms and recruiters.

You can also forward the message to the employment site that was used and advise them that if someone is interested in a position at your organization, they may want to remove the listing.

As a result, the significance of the safest action you could take if you receive a resume on the candidate are the aforementioned.

Learn more about on resume, here:

https://brainly.com/question/862477

#SPJ1

Perception distortions is a process where people would not use shortcuts to give meaning to targets or objects. Question Attachment: Answer O True O False​

Answers

Perception distortion refers to the tendency of individuals to perceive information inaccurately or in a biased manner, often influenced by preconceptions or expectations. It can involve the use of shortcuts or heuristics in processing information. Thus, the given statement in question is false.

Negotiations frequently include perception distortion. A perceiver's inclination toward the other party may result from their own needs, wants, motivations, and personal experiences. Biases and mistakes in perception and subsequent communication may result from this. Stereotyping, halo effects, selective perception, and projection are the four different categories of perceptual distortions.

An inaccurate interpretation of a perceptual phenomenon is referred to as perception distortion. It happens when a person's reaction to external stimuli deviates from what would be considered normal. This distortion may be caused by drug use, physical harm to the brain, or psychological distress.

Learn more about Perception distortions here:

https://brainly.com/question/13815644

#SPJ1

Thermal Rising, Incorporated, makes paragliders for sale through specialty sporting goods stores. The company has a standard paraglider model, but also makes custom-designed paragliders. Management has designed an activity-based costing system with the following activity cost pools and activity rates:



Activity Cost Pool Activity Rate
Supporting direct labor $ 22 per direct labor-hour
Order processing $ 194 per order
Custom design processing $ 268 per custom design
Customer service $ 416 per customer


Management would like an analysis of the profitability of a particular customer, Big Sky Outfitters, which has ordered the following products over the last 12 months:



Standard Model Custom Design
Number of gliders 11 3
Number of orders 1 3
Number of custom designs 0 3
Direct labor-hours per glider 29.50 31.00
Selling price per glider $ 1,825 $ 2,490
Direct materials cost per glider $ 464 $ 584


The company’s direct labor rate is $16 per hour.



Required:

Using the company’s activity-based costing system, compute the customer margin of Big Sky Outfitters. (Round your intermediate calculations and final answer to the nearest whole dollar amount. Loss amounts should be entered with a minus sign.)

Answers

The total costs for Big Sky Outfitters is $6,566, The customer margin of Big Sky Outfitters is $14,123.

How to calculate the company’s activity-based costing system and the customer margin of Big Sky Outfitters.

Calculating the costs for each activity:

1. Supporting direct labor:

Standard Model: 11 gliders x 29.50 direct labor-hours per glider x $16 per hour = $5,152

Custom Design: 3 gliders x 31.00 direct labor-hours per glider x $16 per hour = $1,488

2. Order processing:

Standard Model: 1 order x $194 per order = $194

Custom Design: 3 orders x $194 per order = $582

3. Custom design processing:

Custom Design: 3 custom designs x $268 per custom design = $804

4. Customer service:

Customer Service: 1 customer x $416 per customer = $416

Calculating the total costs for Big Sky Outfitters:

Total costs = Supporting direct labor + Order processing + Custom design processing + Customer service

Total costs = $5,152 + $194 + $804 + $416 = $6,566

Now, let's calculate the total revenues for Big Sky Outfitters:

Total revenues = (Number of gliders x Selling price per glider) - (Number of gliders x Direct materials cost per glider)

Total revenues = (11 x $1,825) - (11 x $464) + (3 x $2,490) - (3 x $584)

Total revenues = $20,075 - $5,104 + $7,470 - $1,752 = $20,689

Finally, let's compute the customer margin:

Customer margin = Total revenues - Total costs

Customer margin = $20,689 - $6,566 = $14,123

Therefore, the customer margin of Big Sky Outfitters is $14,123.

Learn more about customer margin at https://brainly.com/question/29389015

#SPJ1

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
questions.
Online Content: Site 1
What is the main difference in the way that "earned income" and "capital gains (or portfolio income)" are acquired?

Answers

The main difference in the way that "earned income" and "capital gains (or portfolio income)" are acquired is:

Earned income is money gained though occupation.Capital additions are medium of exchange gained though investment(s).

Salary, bonuses, commissions, and tips that you receive from an employer or the company are examples of earned money.

Capital gains are funds received as a result of the sale of an investment such as stocks or real estate. Earned income is often taxed more heavily than gains from investments, which are taxed less heavily.

As a result, the significance of the main difference in the way that "earned income" and "capital gains (or portfolio income)" are acquired are the aforementioned.

Learn more about on earned income, here:

https://brainly.com/question/31313769

#SPJ1

MAKARO SUPERSTORE TRIAL BALANCE 31 December, 2022 Capital 30000$ Plant and Machinery 50,000$ Debtors 200,000$ Creditors 100,000$ Loan 95,000$ Interest on Loan 3,000$ Cash 20,000$ Provision for Doubtful Debts 7,000$ Stock on 1st April, 2017 68,000$ Motor Vehicles 100,000$ Bank 35,000$ Land and Building 120,000$ Bad Debts 5,000$ Purchases 660,000$ Sales 1,100,000$ Purchases Return 15,000$ Sales Return 80,000$ Transportation Out Carriage Outwards 25,000$ Transportation In Carriage Inwards 30,000$ Salaries 90,000$ Rent and Insurance 30,000$ Advertising 35,000$ Discount Received 5,000$ General Expenses 34,000$ Bills Receivable 60,000$ Bills Payable 20,000$ Rent Received 3,000$​

Answers

To prepare the Makara store balance sheet, we will categorize the items into their respective asset, liability, and equity categories.

        MAKARO SUPERSTORE                Balance Sheet      As of 31 December, 2022

Assets:

Plant and Machinery: $50,000

Debtors: $200,000

Cash: $20,000

Stock: $68,000

Motor Vehicles: $100,000

Bank: $35,000

Land and Building: $120,000

Bills Receivable: $60,000

Total Assets: $653,000

Liabilities:

Creditors: $100,000

Loan: $95,000

Interest on Loan: $3,000

Provision for Doubtful Debts: $7,000

Bills Payable: $20,000

Total Liabilities: $225,000

Equity:

Capital: $30,000

Total Equity: $30,000

Total Liabilities and Equity: $653,000

Read more about balance sheet

brainly.com/question/1113933

#SPJ1

17. Why was a fine levied by the Consumer Financial Protection Bureau against Wells Fargo in 2016?
O Wells Fargo employees were opening unauthorized deposit and credit accounts for its customers.
O Wells was selling their customers information to others
O The company was posting incorrect information about its customers to credit bureaus
O The company was given a lower rating by the CFPB.

Answers

Answer:

Wells Fargo employees were opening unauthorized deposit and credit accounts for its customers.

Explanation:

The employees were pressured by the bank mannagers to do this.

Answer: A) Wells Fargo employees were opening unauthorized deposit and credit accounts for its customers.

Explanation: Look at the image below.

Which of the following best explains why a country might specialize in the production of a good?
O Consumers in the country only demand a single good.
O The country believes it is generally better to do one thing really well than multiple things.
The country cannot produce other goods and services.
Specialization allows the country to exchange for more of other goods than it could produce.

Answers

The best explanation for why a country might specialize in the production of a good is specialization allows the country to exchange for more of other goods than it could produce (option D).

Specialization in the production of a particular good enables a country to take advantage of its available resources, labor, and technology to produce that good more efficiently and at a lower cost compared to other countries. As a result, the country can sell its specialized good to other countries in exchange for other goods that it needs but cannot efficiently produce on its own.
For example, if a country specializes in the production of coffee, it can produce coffee beans at a lower cost and higher quality than other countries due to its favorable climate and available resources. The country can then trade its coffee for other goods that it cannot produce as efficiently, such as electronics or machinery.
Specialization also leads to increased productivity and efficiency, as workers can focus on producing a specific good and become highly skilled in that area. This can lead to technological advancements and innovations, which can further improve production efficiency and competitiveness in the global market.
In conclusion, specialization allows a country to leverage its strengths in the production of a specific good, trade it for other goods it needs, and increase productivity and competitiveness.

for more such question on production

https://brainly.com/question/7924898

#SPJ11

True or false “A variable docs t is eventually paid off over time?

Answers

The given statement "A variable docs t is eventually paid off over time" is False. A variable debt, such as a credit card or line of credit, does not necessarily have a fixed repayment period.

The amount owed and the interest rate can fluctuate based on various factors such as changes in the economy or the borrower's credit worthiness. This means that the debt may not be fully paid off over time and could continue to accrue interest and fees.
Additionally, a borrower's financial situation may change over time, making it difficult to make consistent payments towards the debt. Unforeseen circumstances such as job loss or a medical emergency could also impact a borrower's ability to pay off the debt. In these cases, the debt could remain unpaid and potentially even grow larger over time.
It is important for borrowers to carefully manage their variable debts and make timely payments to avoid accruing excessive interest and fees. They may also consider working with a financial advisor or debt management service to create a repayment plan and minimize the impact of variable debt on their overall financial health.

for more such question on variable debt

https://brainly.com/question/17134854

#SPJ11

Question 20 (2 points)
Using the high-low method, what are the fixed and variable costs if the high sales
revenue is $160,000 with total costs of $90,000, and the low sales revenue is
$96,000 with total costs of $58,000. What is the fixed cost and the variable
percentage per dollar of sales revenue?
$9,750 fixed and 32.5% per dollar of sales revenue
$10,000 fixed and 50.0% per dollar of sales revenue
$6,750 fixed and 32.5% per dollar of sales revenue
$4,240 fixed and 56.0% per dollar of sales revenue

Answers

The fixed cost and the variable percentage per dollar of sales revenue Option B. $10,000 fixed and 50.0% per dollar of sales revenue.

To determine the fixed and variable costs using the high-low method, we start by identifying the difference between the high and low sales revenue and the corresponding total costs.

High sales revenue: $160,000

Total costs at high sales revenue: $90,000

Low sales revenue: $96,000

Total costs at low sales revenue: $58,000

Next, we calculate the difference in sales revenue and total costs:

Change in sales revenue = $160,000 - $96,000 = $64,000

Change in total costs = $90,000 - $58,000 = $32,000

The fixed cost can be obtained by subtracting the variable cost component from the total costs at either the high or low sales revenue. Let's use the high sales revenue figures:

Fixed cost = Total costs at high sales revenue - (Variable cost per dollar of sales revenue * High sales revenue)

Fixed cost = $90,000 - (Variable cost per dollar of sales revenue * $160,000)

Using the information provided, we can solve for the variable cost per dollar of sales revenue:

Change in total costs = Variable cost per dollar of sales revenue * Change in sales revenue

$32,000 = Variable cost per dollar of sales revenue * $64,000

Variable cost per dollar of sales revenue = $32,000 / $64,000 = 0.5 or 50.0%

Now, substituting this value back into the equation for fixed cost:

Fixed cost = $90,000 - (0.5 * $160,000)

Fixed cost = $90,000 - $80,000 = $10,000

Therefore, the correct answer is option B: $10,000 fixed cost and 50.0% per dollar of sales revenue.

The question was incomplete, Find the full content below:

Question 20 (2 points)

Using the high-low method, what are the fixed and variable costs if the high sales revenue is $160,000 with total costs of $90,000, and the low sales revenue is $96,000 with total costs of $58,000? What is the fixed cost and the variable percentage per dollar of sales revenue?

A. $9,750 fixed and 32.5% per dollar of sales revenue

B. $10,000 fixed and 50.0% per dollar of sales revenue

C. $6,750 fixed and 32.5% per dollar of sales revenue

D. $4,240 fixed and 56.0% per dollar of sales revenue

Know more about Sales revenue here:

https://brainly.com/question/2177353

#SPJ11

Representative money has value based on:

Answers

Representative money has value based on its representation or claims on a physical or tangible asset. It is a form of currency that is backed by something of intrinsic value, typically a commodity such as gold or silver.

The ability to trade or redeem representational money for the underlying asset it stands for gives it value. Representative money's value is based on the public's confidence in the issuer and their understanding that they may exchange it for the underlying asset. The value of the representative money may be impacted if there are any issues with the issuer's credibility or convertibility.

Learn more about Representative money here:

https://brainly.com/question/30101207

#SPJ1

Would NASA’s decision-making conditions be considered certainty, risk, or uncertainty?
Explain.

Answers

NASA's decision-making conditions are a complex mix of risk, uncertainty, and some level of certainty, as they navigate the challenges of space exploration and strive to make informed and successful decisions.

NASA's decision-making conditions would most likely be considered a combination of risk and uncertainty. While NASA has extensive knowledge and experience in space exploration, there are still many variables that are unknown or unpredictable, such as weather patterns and the behavior of materials in space.

NASA must weigh the potential risks associated with each decision, such as the safety of astronauts and the financial costs, while also considering the uncertain outcomes of their choices. For example, when deciding whether to launch a spacecraft, NASA must consider the risks of mechanical failure, but also the uncertain outcomes of the mission itself, such as the success of scientific experiments or the discovery of new information.

However, NASA also has some level of certainty in their decision-making, as they have a wealth of data and information from past missions and experiments that can inform their choices. They also have a highly trained and knowledgeable team of experts who can provide insights and recommendations based on their expertise.
For more such questions on decision-making visit:

https://brainly.com/question/27004710

#SPJ11


5. (a) Discuss the role and importance of agriculture sector in India.

Answers

The role and importance of agriculture sector in India includes, contribution to GDP, largest source of employment, source of food supply, and helps in industrial development.

Contribution to GDP

The agriculture sector in India is one of the largest sectors. It's contribution to the GDP is around 17% as per 2021 reports.

Largest source of employment

India's agriculture sector is the largest source of employment in India. Most of the people living in the rural areas works in agriculture sector. According to the reports the employment in agriculture sector is around 46%.

Source of Food Supply

India is the home of many crops, cereals and, vegetation. India is now the most populous country in the world. To feed this large population constant supply of food is necessary. Therefore, agriculture sector helps in frequent food supply.

Helps in industrial development

Most of the raw materials for manufacturing different products in the world, comes from India. This helps in the development of different industries in the world.

To learn more about agriculture sector,

https://brainly.com/question/30561347

How might international cooperative space efforts and outsourcing certain tasks to private
contractors affect the decision making done at NASA?

Answers

On the plus side, international collaboration may pool the resources and knowledge of several nations, promoting increased productivity, lower prices, and improved innovation. Access to cutting-edge scientific research, a pooling of resources, and financial support from several nations can all be advantageous for NASA.

NASA science is concentrated on better understanding Earth through the Earth Observing System,[8] advancing heliophysics through the Science Mission Directorate's Heliophysics Research Program,

exploring bodies throughout the Solar System with knowledge cutting-edge robotic spacecraft like New Horizons and planetary rovers like Perseverance,

and researching astrophysics topics, such as the Big Bang, through the James Webb Space Telescope and the Great Observatories.

Learn more about NASA, from :

brainly.com/question/29890206

#SPJ1

why the limitations of the right to freedom of expression should be observed on social media campaigns when citizens are alerted of the dangers of unhealthy living environment​

Answers

Answer:

The right to freedom of expression is a fundamental human right that should be protected and respected. However, in certain situations, such as social media campaigns aimed at alerting citizens of the dangers of unhealthy living environments, it is important to observe the limitations of this right. This is because some forms of expression can have negative consequences on individuals and society as a whole.

How does a graphics card help the computer’s main CPU?

A It provides the wiring that connects the CPU to a monitor.
B It converts analog images into digital signals the CPU can use.
C It connects the CPU of one computer to a group of other computers.
D It takes some load off the CPU, allowing it to work faster.

Answers

Answer:

A graphics card help the computer’s main CPU as it converts analog images into digital signals the CPU can use.

What is CPU?

A central processing unit, also known as a central processor, main processor, or simply processor, is the electronic circuitry that executes computer programme instructions.

The CPU executes basic arithmetic, logic, controlling, and input/output operations as specified by the program's instructions. The CPU is a computer's brain, containing all the circuitry required to process input, store data, and output results.

The CPU is constantly following computer programme instructions that tell it which data to process and how to process it.

T A graphics card assists the main CPU by converting analogue images into digital signals that the CPU can use.

Explanation:

Question 6 of 10
What is one strategy that can help a borrower reduce the cost of a loan?
A. The borrower can choose a credit card with a low minimum
monthly payment.
OB. The borrower can choose a loan with a compound rather than a
simple interest rate.
C. The borrower can choose a credit card with a high minimum
monthly payment.
D. The borrower can choose a loan with a simple rather than a
compound interest rate.

Answers

Answer:

The strategy that can help a borrower reduce the cost of a loan is to choose a loan with a simple interest rate. Therefore, option D is the correct choice.

In a simple interest loan, the interest is calculated only on the principal amount borrowed, whereas in a compound interest loan, the interest is calculated on the principal amount as well as any accrued interest. Therefore, choosing a loan with a simple interest rate will result in a lower overall cost of borrowing. Additionally, the borrower can also reduce the cost of the loan by paying it off as quickly as possible, making extra payments, or negotiating a lower interest rate with the lender.

Question 16 of 40
What is the difference between specialization and cross-training?
A. Specialization is for employees at the top management level of
the company while cross-training is for employees at the entry
level.
B. Specialization is for employees who love what they do while cross-
training is for employees who don't love any one particular area of
their work.
C. Specialization leads employees to focus on a single skill or task
while cross-training deals with training employees in multiple skills
or tasks.
D. Specialization is for employees who have an advanced degree
while cross-training is for those who do not have an advanced
degree.

Answers

The correct answer is C) , Specialization leads employees to focus on a single skill or task while cross-training deals with training employees in multiple skills or tasks.

Specialization and cross-training differ in terms of the focus of training and development. Specialization involves employees focusing on developing expertise in a particular skill or area of work. It often involves becoming highly proficient and knowledgeable in a specific field or task.

Specialization allows employees to become experts in their chosen area and can lead to increased efficiency and productivity in that particular domain.

On the other hand, cross-training involves training employees in multiple skills or tasks that are outside of their primary area of expertise. It aims to provide employees with a broader skill set and the ability to perform different roles within an organization.

Cross-training helps in creating a more flexible workforce that can adapt to changing needs and handle a variety of tasks. It also enhances collaboration and teamwork by enabling employees to understand and appreciate the work of their colleagues in different areas.

Specialization and cross-training are both valuable approaches depending on the organizational needs and employee roles.

Specialization is beneficial when deep expertise and mastery in a specific area are required, while cross-training is advantageous for fostering versatility and adaptability among employees.

To know more about Specialization refer here

https://brainly.com/question/28331255#

#SPJ11

What type of life insurance do employers usually offer as a benefit?
O whole life
O universal life
O 1-year renewable group term life
O 20-year Term life.

Answers

Answer:

 1-year renewable group term life is the type of life insurance employers usually offer as a benefit.

Explanation:

Answer: C) 1-year renewable group term life

Explanation: Group with a one-year renewable contract Term life insurance is the sort of life insurance that most businesses provide as a perk.

How should expatica enter into the international markets ?​

Answers

Expatica should enter into international markets by conducting extensive market research to identify potential markets and their unique cultural, economic and regulatory differences.

The process conducting extensive market research to identify potential markets and their unique cultural, economic and regulatory differences will help Expatica to tailor its offerings to meet the specific needs and preferences of each market. The company should also partner with local businesses to gain access to their networks and expertise in navigating the local market. Expatica should establish a strong online presence to reach a wider audience and invest in digital marketing to increase brand visibility and awareness. Additionally, the company should ensure compliance with local laws and regulations, and adapt to local customs and language to establish credibility and build trust with customers. Continuous monitoring of market trends and consumer preferences is crucial to ensure that Expatica remains competitive and relevant in each international market it enters.

For similar question on potential markets:

https://brainly.com/question/8215105

#SPJ11

Which research strategy is best for finding current journal articles about a topic

Answers

When it comes to finding current journal articles about a specific topic, the most effective research strategy is to utilize online academic databases and search engines.

One of the best research strategies is, to begin with a comprehensive and reputable academic database, such as PubMed, or JSTOR. These databases index a wide range of scholarly literature, including journal articles, conference papers, and dissertations. They have advanced search features that allow you to refine your search based on specific criteria, such as publication date, author, or keywords.

Additionally, subscribing to discipline-specific journals or joining professional organizations in your field can provide you with access to the latest research through journal subscriptions or newsletters. Many journals offer online access to their articles, allowing you to stay updated with the latest scholarly publications.

It's important to note that the availability of current journal articles may vary depending on the field of study and the specific topic. Some emerging or niche subjects might have limited research available. In such cases, it's recommended to expand your search to related fields or interdisciplinary research to find relevant and current articles.

By utilizing online academic databases, setting specific search parameters, and exploring discipline-specific journals, you can employ the best research strategy to find current journal articles and stay informed about the latest developments in your area of interest.

Know more about Databases here:

https://brainly.com/question/518894

#SPJ11

Discuss the importance of communication in the lives people, business, government, Non-government and others in authority in today's world. Give one practical example to support discussion.​

Answers

Communication plays a crucial role in the lives of people, businesses, governments, and non-governmental organizations in today's world.

Effective communication ensures that people can exchange ideas, share information, and express their thoughts and opinions, thereby building relationships, enhancing understanding, and promoting cooperation.

In business, communication is essential for successful operations. It enables businesses to communicate with customers, suppliers, and employees, to coordinate activities and make decisions. Effective communication also helps businesses to establish and maintain a positive reputation and brand image.

In government and non-governmental organizations, communication is essential for building public trust, disseminating information, and promoting transparency and accountability. Effective communication enables governments to inform citizens about policies, laws, and regulations, to obtain feedback and input from stakeholders, and to build consensus and support for initiatives.

One practical example of the importance of communication is the response to the COVID-19 pandemic. Effective communication has been critical in informing the public about the risks and dangers of the virus, promoting preventive measures such as social distancing and wearing masks, and providing updates on vaccine availability and distribution.

Governments, businesses, and healthcare organizations have used various communication channels, such as social media, news outlets, and press conferences, to disseminate information and updates on the pandemic, thereby building trust and reducing anxiety and confusion among the public.

For more such questions on Communication visit:

https://brainly.com/question/25020821

#SPJ11

Answer:

Communication is an essential part of our everyday lives, and it plays a crucial role in many aspects of society, including people, business, government, non-governmental organizations, and other authorities. Effective communication is important because it allows us to share ideas, express our thoughts and emotions, and build relationships with others.

In business, communication is crucial for success. It enables employees to work together effectively and efficiently, and it allows businesses to interact with customers and other stakeholders. For example, a company might use social media to communicate with customers about new products or promotions. Effective communication can help to build trust and loyalty with customers, which can lead to increased sales and revenue.

In government, communication is important for ensuring that policies and decisions are communicated effectively to the public. It enables citizens to participate in the democratic process and hold their elected officials accountable. For example, a government might use public forums or town hall meetings to communicate with citizens about new policies or initiatives. Effective communication can help to build trust and confidence in government, which can lead to greater civic engagement and participation.

In non-governmental organizations, communication is important for raising awareness about important social issues and advocating for change. It enables organizations to communicate their message to the public and to mobilize support for their cause. For example, a non-governmental organization might use social media to raise awareness about environmental issues or human rights abuses. Effective communication can help to build a movement around a particular cause, which can lead to positive change.

One practical example of the importance of communication is during a crisis. Effective communication is essential during a crisis, whether it be a natural disaster, a public health emergency, or a terrorist attack. In these situations, communication can help to provide important information to the public, calm fears and anxieties, and coordinate response efforts. For example, during the COVID-19 pandemic, effective communication from public health officials was crucial in informing the public about the virus, how to prevent its spread, and what to do if they were infected. This communication helped to slow the spread of the virus and save lives.

Please complete the follow activity.

Answers

Here are examples of risks that can affect start ups.

FailureCash flow problems

How can some of the above risks be removed?

The danger of failure is one of the most prevalent hazards for startups. While failure is unavoidable when establishing a business, there are a number of variables that might enhance the risk of failure. These include a lack of preparation, insufficient financing, ineffective management, and unreasonable expectations.

An entrepreneur must assess a risk before taking it in order to reduce potential dangers. The majority of entrepreneurs specialize in risk assessment. They don't lose much if the plan fails, but if it works, they gain a lot by taking the risk.

Learn more about startup risk:
https://brainly.com/question/30471305
#SPJ1

Type the correct answer in the box. Spell all words correctly.
Which forecasting technique involves analysts using the aggregate opinion of expert panelists, along with justified reasoning, to estimate future sales scenarios?


The_____ involves analysts using the aggregate opinion of expert panelists.

Answers

Answer:

The Delphi method is involved......

According to the law of supply, an increased price for a good should lead to: OA. a decreased demand for that good. OB. a decreased supply of that good. C. an increased demand for that good. OD. an increased supply of that good. SUBMIT​

Answers

Answer: OD. an increased supply of that good.

Explanation:

1.Apply the SOSTAC model to ASOS and highlight why it has become
such a successful online fashion brand?

Answers

he SOSTAC model is a strategic planning framework that stands for Situation analysis, Objectives, Strategy, Tactics, Action, and Control.

Situation analysis: ASOS operates in the highly competitive and dynamic online fashion industry. It was founded in 2000 and has grown rapidly since then to become a global brand with a presence in over 200 countries.

Objectives: ASOS's objective is to become the go-to destination for online fashion shopping. It aims to provide its customers with a seamless and personalized shopping experience that caters to their unique style preferences.

Strategy: ASOS's strategy is centered on offering a wide range of products from its own label as well as other brands, at competitive prices. It also uses technology to enhance the customer experience by providing features like visual search, social media integration, and personalized recommendations.

Tactics: ASOS uses various tactics to execute its strategy, such as aggressive marketing campaigns, partnerships with influencers, and collaborations with other brands. It also invests heavily in technology to constantly improve its online platform and provide customers with a seamless shopping experience.

Action: ASOS regularly updates its product offerings, website design, and marketing campaigns to stay relevant and appeval to its target audience. It also actively engages with its customers through social media and other channels to understand their preferences and needs.

ASOS has become such a successful online fashion brand due to its effective execution of the SOSTAC model. Its focus on offering a wide range of products at competitive prices, using technology to enhance the customer experience, and actively engaging with customers has helped it establish a strong brand identity and a loyal customer base.

For more such questions on strategic planning visit:

https://brainly.com/question/17924318

#SPJ11

At the end of 2011, the XYZ city deferred Br. 40,000 in property taxes, and that amount is reflected in the beginning balance sheet is recognized as revenue for 2012.

Answers

It is TRUE to state that at the end of 2011, the XYZ city deferred Br. 40,000 in property taxes, and that amount is reflected in the beginning balance sheet is recognized as revenue for 2012.

Why is tax deferred in property taxes recognized as revenue?

Tax deferred in property taxes is recognized as revenue because it represents an obligation to the entity and will be collected in the future.

Investment earnings, such as interest, dividends, or capital gains, that grow tax-free until the investor takes constructive receipt of the profits, are referred to as tax-deferred status.

Learn mor about Tax deferred:
https://brainly.com/question/31965060
#SPJ1

Full Question:

At the end of 2011, the XYZ city deferred Br. 40,000 in property taxes, and that amount is reflected in the beginning balance sheet is recognized as revenue for 2012.

True or false?

what is business management

Answers

Business management is the process of organizing, planning, leading, and controlling the resources of an organization to achieve its goals and objectives.

Business management involves coordinating human, financial, and technological assets to ensure the organization's success. In business management, managers develop strategies, implement policies, and make decisions to direct the operations of the company. They also monitor performance and make necessary adjustments to achieve desired outcomes. Key components of business management include strategic planning, operational management, human resource management, financial management, and marketing management. By effectively managing these elements, business managers help organizations maximize profits, maintain a competitive edge, and create a sustainable growth path. Overall, business management is crucial for the success and growth of any organization, as it allows for the efficient utilization of resources and the achievement of strategic objectives.

For similar question on Business management:

https://brainly.com/question/28072798

#SPJ11

liquidity of fixed deposits​

Answers

Fixed deposits, also known as term deposits, generally have lower liquidity compared to other types of financial instruments.

How liquid are fixed deposits ?

In the case of fixed deposits, the funds are typically locked in for a specified period, known as the term or maturity period. During this period, the depositor cannot withdraw the funds without incurring penalties or forfeiting interest.

The duration of the term deposit can vary, ranging from a few months to several years, depending on the terms set by the financial institution.

However, it is important to note that fixed deposits may offer varying degrees of liquidity depending on the specific terms and conditions set by the financial institution.

Some institutions may allow early withdrawals, but at the cost of reduced interest earnings or penalties.

Find out more on fixed deposits at https://brainly.com/question/30237414

#SPJ1

Full question:

Discuss the following topic:

Liquidity of Fixed deposits

A group of people that maintains a certain set of values, beliefs, language is best described by which
of the following terms?

Answers

A group of people that maintains a certain set of values, beliefs, language is best described by a. Culture

What is the people about?

Culture is one that is made up of the collective principles, convictions, regulations, dialect, traditions, actions, and establishments that are embraced by a distinct community.

The essence of a particular society or community is formed and characterized by its shared identity, customs, and modes of existence. The transmission of culture across generations shapes the behavior, mindset, and outlook of individuals.

Learn more about Culture from

https://brainly.com/question/25010777

#SPJ1

A group of people that maintains a certain set of values, beliefs, language is best described by which

of the following terms?

a. Culture,

b. Ethnocentricity,

c. Social beliefs,

d. Institutional society.

Apply any five factors that should be considered when Pick n Pay chooses locations for its Boxer stores in South Africa.

Answers

Five factors that should be considered when Pick n Pay chooses locations are:

population density,income levels,competition,accessibility,infrastructure development.

What is the important factors to consider when selecting locations?

When selecting locations for Boxer stores in South Africa, Pick n Pay should consider the population density in a particular area. Higher population density typically translates to more potential customers and a larger customer base for the store.

The income levels play a crucial role in determining the purchasing power of the local residents. Areas with higher income levels may be more attractive for Boxer stores as they are likely to have customers who can afford to shop regularly.

Read  more about sales factors

brainly.com/question/30673688

#SPJ1

Other Questions
Which of the following is represents an estimate of S edx using rectangles with heights given by right- hand endpoints and four subintervals (i.e. n 4)? Select one: o So e*dx is approximately (0.5)e0.5 + (0.5) + (0.5)1.5 + (0.5)e? o lo e* dx is approximately (0.5) + (0.5)e0.5 + (0.5) + (0.5) 1.5 o e*dx is approximately (0.5)e0.5 + (1)e! + (1.5)e1.5 + (2)e2 o fe*dx is approximately 2e2 Which apparatus can be used to monitor the rate of this reaction? CH3COCH3 (aq) + I2 (aq) CH3COCH2I (aq) + H+ (aq) + I- (aq) I. A pH meter II. A gas syringe III. A colorimeter A I and II only B I and III only C II and III only D I, II and III sucrose (suc) enters the series of reactions in glycolosis after its hydrolysis into glucose (glc) and fructose (fru): when applying linear programming to blending problems, the objective function is usually designed to in a beryllium atom ( z=4 ), how many electrons are in the k shell? express your answer as an integer. Which weather phenomenon is always associated with a thunderstorm?a) lightningb) heavy rainc) hail .Which motherboard form factor allows for low-consumption power supplies?A. Mini-ITXB. EATXC. NLXD. microATX HELP NEED IT TODAY ASAPPolygon ABCD is drawn with vertices A(4, 4), B(4, 6), C(1, 6), D(1, 4). Determine the image coordinates of B if the preimage is reflected across y = 3. B(4, 6) B(4, 12) B(1, 3) B(10, 6) avoiding plagiarism, citing sources, and maintaining academic integrity: for what reason might a company acquire treasury stock? Given the vectors A=i+2j+3k, B= +2j+k and C=4ij, determine x such that A+XB is perpendicular to C. (5 marks) how can someone under 18 open their own brokerage account? The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig? match the parametric equations with the correct graph. x = cos(8t), y = sin(8t), z = e0.8t, t 0 According to this passage, why is Cassius so frustrated with Caesar?Cassius believes Caesar to be a god.Cassius is angry because Caesar has a bad temper and is rude to people.Cassius is concerned that the strain of ruling will put unnecessary stress on Caesars overall health.Cassius cannot believe that a man with all of Caesars weaknesses can become so powerful. 2. what are some similarities and differences between skimming pricing, prestige pricing, and above-market pricing? Glycolysis depends on a continuous supply of: a. NADP b. pyruvate c. NAD+ d. NADH e. H2O Douglas Diners Inc. Charges an initial franchise fee of $90,000 broken down as follows: Rights to trade name, market area, and proprietary know-how$40,000 Training services11,500 Equipment (cost of $10,800)38,500 Total initial franchise fee$90,000 Upon signing of the agreement, a payment of $40,000 is due. Thereafter, two annual payments of $30,000 are required. The credit rating of the franchisee is such that it would have to pay interest of 8% to borrow money. The franchise agreement is signed on August 1, 2014, and the franchise commences operation on November 1, 2014. Assuming that no future services are required by the franchisor once the franchise begins operations, the entry on November 1, 2014 would include a. A credit to Unearned Franchise Revenue for $40,000. b. A credit to Service Revenue for $11,500. c. A credit to Sales Revenue for $38,500. d. A debit to Unearned Franchise Revenue for $40,000 .1. Discovered the conscious and unconscious part of the mind2. His studies were the basis for psychology and psychiatry in what identification procedure are suspects entitled to legal representation?