1. Which of the following types of energy is
potential energy? More than one answer is
possible,
A kinetic energy
B.thermal energy
C.sound energy
D.gravitational energy

Answers

Answer 1

Answer:

Potential energy is stored energy and the energy of position––gravitational energy. There are several forms of potential energy. Electrical Energy is the movement of electrical charges. Everything is made of tiny particles called atoms.


Related Questions

Block 1, of mass m1
m
1
= 0.500 kg
k
g
, is connected over an ideal (massless and frictionless) pulley to block 2, of mass m2
m
2
, as shown. For an angle of θ
θ
= 30.0 ∘

and a coefficient of kinetic friction between block 2 and the plane of μ
μ
= 0.400, an acceleration of magnitude a
a
= 0.450 m/s2
m
/
s
2
is observed for block 2.
Find the mass of block 2, m2
m
2
.

Answers

Answer:

M2=0.52kg

Explanation:

thats rightt

4. In not less than 150 words, write your substantial insights on what you have learned in the past modules in relevance to what is happening now.​

Answers

Answer:

“I think it’s about putting yourself in the students’ shoes and seeing how a first-time student, maybe someone who hasn’t even taken chemistry before, is looking at it.”

—Valerie Taraborelli, undergraduate chemistry student, University of Arizona1

“In some ways, I think the people who are the most successful as teachers are the ones who are able to remember what it was like being uncertain and not knowing. When you become an expert, things are easy. So the idea is to try and see where [students] are coming from and why they’ve developed this misconception and what you can do to specifically address it.”

—Dee Silverthorn, biology professor, University of Texas2

Hope this helps !!

A bullet of mass 20 g has its kinetic energy equal to 400 J. Find the speed of the bullet.

Answers

Answer:

m=20g=0.02kgK.E=400J

[tex]\\ \sf\longmapsto KE=\dfrac{1}{2}mv^2[/tex]

[tex]\\ \sf\longmapsto \dfrac{1}{2}(0.02)v^2=400[/tex]

[tex]\\ \sf\longmapsto 0.01v^2=400[/tex]

[tex]\\ \sf\longmapsto v^2=40000[/tex]

[tex]\\ \sf\longmapsto v=200m/s[/tex]

Which of the following statements cannot be supported by Kepler's laws of planetary motion?


A planet's distance from the sun will not be the same in six months.


A planet's speed as it moves around the sun will not be the same in six months.


The rotational speed of the four smallest planets can be determined using the rotational speeds of the four largest planets and their orbital periods.


The average distance of Saturn can be calculated using the average distance of Neptune and the orbital period of both planets.

Answers

the second
option is the answer

A number line goes from negative 5 to positive 5. Point D is at negative 4 and point E is at positive 5. A line is drawn from point D to point E. What is the location of point F, which partitions the directed line segment from D to E into a 5:6 ratio? Negative one-eleventh One-eleventh Two-fifteenths Fifteen-halves.

Answers

The location of the point F that partitions a line segment from D to E ([tex]\overline{DE}[/tex]), that goes from negative 4 to positive 5, into a 5:6 ratio is fifteen halves (option 4).  

We need to calculate the segment of the line DE to find the location of point F.

Since point D is located at negative -4 and point E is at positive 5, we have:

[tex] \overline{DE} = E - D = 5 - (-4) = 9 [/tex]

Hence, the segment of the line DE ([tex]\overline{DE}[/tex]) is 9.

Knowing that point F partitions the line segment from D to E ([tex]\overline{DE}[/tex]) into a 5:6 ratio, its location would be:

[tex] F = \frac{5}{6}\overline{DE} = \frac{5}{6}9 = 5*\frac{3}{2} = \frac{15}{2} [/tex]  

Therefore, the location of point F is fifteen halves (option 4).

Learn more about segments here:

https://brainly.com/question/24472171?referrer=searchResultshttps://brainly.com/question/13270900?referrer=searchResults

       

I hope it helps you!

Answer:

The above answer is actually incorrect - the real answer is B. 1/11

Explanation:

I'm adding a ss below for proof

Hope this helped!

I'd really appreciate Brainliest :)

An object is projected into the air with a vertical velocity of 20 feet per second. At what times will the object be on the ground

Answers

Answer:

20 ft/sec / 32 ft/sec^2 = .625     to reach top

2 * .625 = 1.25

It will be on the ground at t = 0 and t = 1.25

You can also solve the equation:

H = 0 = V0 t - 1/2 g t^2

Obviously, at t=0 h = 0

V0 = 1/2 g t    is a solution

t = 20 * 2 / 32 = 1.25 sec

Situation You are going through a very rough time. You feel so down that you need someone to talk to you send a text message to your friend asking her if she could come over to make you feel better. You friend gives you a call then tells you she will be there in 20 minutes. You are so happy to see her, you give her a big hug. then pour your heart out. After crying to her for a good 30 minutes. she gives some comforting words. You finally say that you feel so much better. Your mend then says. "That's good to know. Now we're done, could we settle my expenses for this - 20 pesos for the phone call, 35 pesos for the tricycle nde going to your place, 20 pesos for all the tissue paper you drew from my tissue pack, and 10 pesos for the time I lost to working productively because had to come here. Thanks." What would be your reaction to your friend after she says this? Fourreaction​

Answers

Answer:

she is your bestfriend so she should always be there for you as long as you are there for them but be like omg im so sorry.

Explanation:

wow tea is pouring

in any chemical reaction or physical change the mass of the product is ___ The mass of the reactant
a. The relationship cannot be determined by the amount of information given
b. equal to or the same
c. twice is greater than
d. twice as less than

Answers

Answer: b. equal to or the same

In Law of Conservation of mass,  the mass of the product equals the mass of the reactant. A reactant is the chemical reaction of two or more elements to make a new substance, and a product is the substance that is formed as the result of a chemical reaction.

pls mark brainliest! i really need one :(

A cat that has a mass of 6 kg climbs to the top of a tree that is 20 m high. How much potential energy does the cat have at the top of the tree?

Have a great day!

Answers

Answer:

1176.798 J

Explanation:

[] Use the following equation:

U = mgh

m - mass

g - gravitational field

h - height

Have a nice day!

     I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)

- Heather

18 through 22 multiple choice please help

Answers

Answer:

18:equilibrium

19:10.8

20:separating the surfaces with a layer of air

21:it remains motionless

22:cm/s

A racing car has a mass of 750 kg. It undergoes an acceleration of 4.00 m/s2. What is the net force acting on the car?

Answers

Answer:

3000 N

Explanation:

The force acting on an object given it's mass and acceleration can be found by using the formula

force = mass × acceleration

From the question we have

force = 750 × 4 = 3000

We have the final answer as

3000 N

Hope this helps you

describe the working principle of a hydraulic press using pascals principle

Answers

Answer:

A hydraulic press works on the principle of Pascal's law, which states that when pressure is applied to a confined fluid, the pressure change occurs throughout the entire fluid. Within the hydraulic press, there is a piston that works as a pump, that provides a modest mechanical force to a small area of the sample.

Explanation:

which technique of extrasolar planet detection can tell us about the orbital period of a planet?

Answers

astrometric, Doppler, and transits) tell us the orbital period of detected planets. You

please help me! i’ll mark brainliest if you’re correct!

Answers

The answer is that the resultant force is the vector sum of the component forces. In your simple example, where the component forces (F1 and F2) are at right angles to one another, as illustrated below, then the resultant force (r) is given by:

[tex]r= \sqrt{(f_{1}) {}^{2} +( f_{2})^{2} + 2f_{1}f_{2}. cos \: Θ, } \\ where \\ \: Θ, = angle \: between \: f_{1} \: and \: f_{2} \\ r = \sqrt{(2) {}^{2} + (5) {}^{2} + 2 \times 2 \times 5 \times cos90 } \\ \sqrt{4 + 25} = \sqrt{29} = 5.385 \\ nearest \: hundred = 5.39[/tex]

Answer: 3N to the right

Explanation: 2N- 5N= 3N

40 POINTSS. Now explore friction force. Set the piece of plastic or wood on the table and push it steadily across the tabletop using your fingertip. Note how much opposition to your push you feel. Repeat the steps, but this time push the piece of plastic or wood across a rug, carpet, or piece of fabric. If you’re using fabric, be sure to secure the fabric so it doesn’t move. How does the opposition to motion on the tabletop compare with that of the rug, carpet, or fabric? WILL MARK BRAINLIST IF RIGHT

Answers

Answer: If there is a higher friction, the opposition force is higher so that it can reduce our speed. So, a factor that affects friction is the roughness or smoothness of the surface of the object. In comparison of the table with the fabric, the fabric will have a more opposition force. As the surface of the fabric is usually rougher than the surface of a smooth table. As there is more friction on a fabric, we will feel more opposition force on our finger tip.

Was there any angle given with the question

Answers

Answer:

No.

Explanation:

In the question, no mathematical angle is shown.

me (5) A taxi is travelling at 15. m/s. Its driver accelerates with acceleration 3 m/s for 4 s. What is its new velocity? A car accelerates from 20 m/s to 30 m/s in 10 (a) Calculate the car's acceleration using v=utat. (b) Draw a velocity-time graph to show the car's motion. Find the distance it travels by calculating the area under the graph. (c) Check your answer by using the equation s = ut + hat Grade 9​

Answers

Answer:

5)

Solution

initial velocity = 15 m/s

acceleration = 3m/s^2

time = 4 s

final velocity = 15+3×4

=15+12

=27m/s

A car accelerates from 20m/s to 30m/s in 10 second

T9 be honest I think some part of the second question is missing

A wave has frequency of 50 Hz and a wavelength of 10 m. What is the speed of the wave?
I need the Formula,Known,Substitute & Solve Answer with Units

Answers

Answer:

This is the answer that I got.

Explanation:

Hope it is right.

how does cells and tissues work together with the brain to do its job

Answers

Cells are grouped together to carry out specific functions. A group of cells that work together form a tissue. Your body has four main types of tissues, as do the bodies of other animals. These tissues make up all structures and contents of your body.

about conserving and protecting our coral reefs. 3. Punch a hole and put ribbon or string on it. Rubrics will serve as your guide in creating your bookmark. (SAMPLE BELOW) Protect Keep it our clean! Corals! de Questions: 1. What was your awareness message all about in your bookmark? 5. Do you believe there is a need to protect our coral reefs after doing this activity? Why? The Tubbataha Reef in Palawan is our country's pride. It is one of UNESCO World Heritage Sites. What would you suggest our government do to protect this?​

Answers

The above question requires a personal answer about your perception of corals, environmental conservation, and the activity you did in the classroom. In that case, I can't answer your question, but I'll show you how to answer it.

Please consider the following information to answer your questions:

The awareness message about corals refers to their preservation, due to their environmental and economic importance.After doing your activity you should be able to understand the importance of preserving corals. That's because they are important for fish spawning and habitat, blocking wave erosion, and protecting coastal communities.To protect coral reefs, the government must map reef areas, reduce marine pollution, monitor fish exploitation, protect coral areas and encourage environmental education and awareness of nature conservation.

In summary, coral reefs must be protected so that the natural marine balance is maintained.

More information about coral reefs at:

https://brainly.com/question/4526021

A 3 Kg ball at the end of a string is spun in a circle. If the length of the string is 2 m and the velocity of the ball is 6 m/s, what is the centripetal acceleration of the ball? What is the centripetal force on the ball?

Answers

m is 3kg
r is 2m
v is 6m/s

Fc = mv^2 / r
Fc = (3x6^2)/2 =54

a = v^2/r
a = 6^2 /2 = 18

i. la protagonista ama a su gata. escribimos, en nuestros cuadernos , las razones por las que pensamos que las personas aman de manera exagerada a sus mascotas. Proponemos un antídoto para la soledad. Lo escribrimos

Answers

Las mascotas son una buena fuente de compañía y socias en la soledad.

La protagonista ama a su gato porque las mascotas son una buena fuente de compañía y es un antídoto para la soledad. Estas mascotas como perros, gatos, loros, etc. dan placer y felicidad a las personas.

La gente tiene mascotas para pasar tiempo con ellas y jugar con ellas para refrescar sus mentes. Tener mascotas es una actividad maravillosa que hace que nuestra mente esté relajada y llena de felicidad, por lo que podemos concluir que las mascotas son una buena fuente de compañía y compañera en la soledad.

Learn more about pest here: https://brainly.com/question/989131

Learn more: https://brainly.com/question/25948065

Two lumps of clay approach each other from opposite directions and collide head on inelastically, combing into one large lump after they collide. the first lump has a mass of 0.140kg and has a speed of 3.50 m/s before the Collision. the second lump has a mass of 0.620kg and has a speed of 4.81 m/s before the collison in a direction opposite that of the first lump. what velocity does the combined lump have after the collision?

Answers

Answer:

Before collision:

momentum to right = .14 * 3.5 = .49 kg m / s

momentum to left = .62 * 4.81 = 2.98 kg m / s

Total momentum = .49 - 2.98 = - 2.49 to left

M V = -2.49    net momentum to left

V = -2.49 / (.14 + .62) = -3.28 m/s to left

how do you find average velocity (average) from acceleration) and time (t)?

Answers

Average velocity is defined as the ratio in change in position to change in time,

v[ave] = ∆x/∆t

which on its own doesn't have anything to do with acceleration.

If acceleration is constant, the average velocity is the literal average of the initial and final velocities,

v[ave] = (v[final] + v[initial]) / 2

If this constant acceleration has magnitude a, the final velocity can be expressed in terms of the initial velocity by

v[final] = v[initial] + a*t

and plugging this into the previous equation gives

v[ave] = (v[initial] + a*t + v[initial])/2

v[ave] = v[initial] + 1/2*a*t

If the body in consideration is initially at rest, then

v[ave] = 1/2*a*t

which might be the relation you're looking for. But bear in mind the conditions I've underlined.

If acceleration is not constant and changes over time, so that the acceleration is some function of time a(t), then you can determine the velocity function v(t) by using the fundamental theorem of calculus. You need to know a particular velocity for some time to completely characterize v(t), though. For example, if you're given the initial velocity v[initial] = v(0), then

[tex]\displaystyle v(t) = v(0) + \int_0^t a(u) \, du[/tex]

or if you know any other velocity for some time t₀ > 0,

[tex]\displaystyle v(t) = v(t_0) + \int_{t_0}^t a(u) \, du[/tex]

Identify the class of lever whch is not used for lifting heavy loads but as used for making work faster. Explain your answer. ​

Answers

Answer:

3 class lever .

Explanation:

Third class lever: In the third class lever, the effort is located in between fulcrum and load. Here, effort arm is shorter than the load arm. It cannot lift the heavy load but increases the speed of doing work. ............. can you me as brainlist pls

Why aren’t the Appalachian Mountains still as tall as the Himalayas?

Answers

Answer:

mountains are limited in their theoretical height by several processes. First is isostasy: the bigger a mountain gets, the more it weighs down its tectonic plate, so it sinks lower. ... Bottom line: mountains can get taller than Mount Everest in earth gravity, like the Appalachians probably did—but not much taller.

Answer:

It probably won't get any taller, though. From a geological standpoint, the Appalachians haven't seen much growth in quite a while. Since the dawn of the dinosaurs about 225 million years ago, this range has been getting whittled down by weathering forces.

Explanation:

Help it’s multiple choice 11 through 15 please!

Answers

1. • Here, force of gravity on the block = 20 N.

• Therefore, the normal force will also be the same, i.e., 20 N [According to Newton's Third Law, on every action, there is an equal and opposite reaction]

• The coefficient

[tex] u_{k} = 0.4[/tex]

• Force of friction =

[tex]u_{k} \times \: normal \: \: \: force \\ = 0.4 \times 20N \\ = 8N[/tex]

• Hence, the force of sliding friction between the block and the ground is 8 N.

• So, it is option c. 8 N

2. The answer is option d. continue in the same direction with no change in speed.

We know, force = mass × acceleration. When force is 0, then acceleration will also be 0 since mass cannot be 0. So, there will be no change in speed.

3. It is option b. force that is required to give a one kilogram object the acceleration of 1 m/s^2.

Newton is the SI unit of force. As mentioned earlier, force = mass × acceleration. The SI unit of mass and acceleration is Kg and m/s^2 respectively.

So, 1 N = 1 Kg × 1 m/s^2.

4. It is d. not zero.

Acceleration is the change in speed. So, if the force is zero, then acceleration will not occur.

5. Force = 2 N

Acceleration of the object A = 2 m/s^2.

Acceleration of the object B = 1 m/s^2.

Therefore, mass of the object A = 2 N ÷ 2 m/s^2 = 1 Kg

And, mass of the object B = 2 N ÷ 1 m/s^2 = 2 Kg

So, the mass of object B is greater than that of object A.

Hence, the answer is option c. Object B has more mass.

Hope you could get an idea from here.

Doubt clarification - use comment section.

What ions are produced from acids and bases?

Answers

Answer:

Give person above me brainliest

Explanation:

A 0.24 kg mass with a speed of 0.60 m/s has a head-on collision with a 0.26 kg mass that is traveling in the opposite direction at a speed of 0.20 m/s. Assuming that the collision is perfectly inelastic, what is the final speed of the combined masses?

Answers

Answer:

  0.184 m/s

Explanation:

Momentum is conserved. If the velocity of the 0.24 kg mass is positive, then ...

  m1v1+m2v2 = m3v3

  (0.24 kg)(0.60 m/s) +(0.26 kg)(-0.20 m/s) = (0.24 +0.26 kg)(v)

  v = (0.144 -0.052 kg·m/s)/(0.50 kg) = 0.184 m/s

The speed of the combined masses is 0.184 m/s.

_____

Additional comment

The positive sign indicates the combined masses are moving in the direction of the original 0.24 kg mass.

Help me as soon as possible <3​

Answers

Answer: ??? what the

Explanation:

Other Questions
Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 = how does one make a plush design for a character with floating limbs metabolism is the chemical process your body uses to breakdown and transform food Help help help help help