Can anybody help me with this pls...

Can Anybody Help Me With This Pls...
Can Anybody Help Me With This Pls...

Answers

Answer 1

Answer:

speak the truth its asking u opinons

Explanation:

thats all u need to do


Related Questions

Younger adults are more likely to be influenced by anxiety, _____, and anger when making decisions than older adults.

Answers

Answer:

stress

Explanation:

how do you evalute the political development of our country​

Answers

Answer:

Abstract

The political context of and approaches to program evaluation in the United States and in developing countries are compared. A framework for discussing the political context of evaluation in developing countries is proposed. This framework includes who funds, uses, controls, and conducts the evaluations; what kinds of evaluations are used by major stakeholders; and how and why evaluations are used. Some of the emerging issues are discussed.

Although the political nature of evaluation is accepted as a fact of life by American evaluators, there has been very little systematic discussion of these issues with respect to evaluation in developing countries. Probably the single most important difference between the context for program evaluation in the United States and that in developing countries is the major role that international donor agencies play in the selection, financing, design, and use of monitoring and evaluation systems in developing countries.

Another important issue is that in many developing countries monitoring and evaluation systems are often highly centralized, with priority given to the information needs of central finance and planning agencies. Consequently, evaluation in developing countries is used less as a project management tool than in the United States. Also in contrast to the United States, where the need for stakeholder analysis is widely acknowledged, project beneficiaries in developing countries frequently receive very limited attention from both donors and governments and have no voice in the design, implementation, or use of the evaluations.

Explanation:

Your Free Read It

Brainlist nalang

Answer:

     Broadly, The development of institutions, attitudes and values the forms the political power system of society. Political development enhances the state's capacity to mobilize and allocate resources, to process policy inputs into implementable outputs.

                     ...........................

D
5. In all organisms, the coded instructions for specifying
the characteristics of the organism are directly
determined by the arrangement of the
A) twenty kinds of amino acids in each protein
B) twenty-three pairs of genes on each chromosome
C) stands of simple sugars in certain carbohydrate
molecules
D) four types of molecular bases in the genes

Answers

b) 23 pairs of chromosomes

explanation: learned in bio

which religious group was the first to form an abolitionist group?

Answers

Answer:

The Quakers

Explanation:

What is the name of the famous pass crossing the area where Kentucky, Tennessee, and Virginia meet?​

Answers

It Is Cumberland Pass
Cumberland Pass bccs i just know it


Prior to the Battle of Yorktown, George Washington planned to

Answers

Answer:

He would fool Clinton into thinking the Continentals were planning to attack New York while instead sneaking away to the south to attack Cornwallis

Explanation:

Answer:

“He would fool Henry Clinton into thinking the Continentals were planning to attack New York while instead sneaking away to the south to attack Cornwallis,”

Explanation:

learning by observing and imitating others is called

Answers

Observational learning? (it also depends on what you're learning)

listen to the a and b sections of rejoice greatly from handel’s messiah. which best describes the b section?

Answers

The best that describes the B section is:

It makes a shift to a minor tonality.

Let's understand what a tonality is all about.

Tonality Tonality, in music refers to the principle of actually organising musical compositions.

The arrangement is done around the central note, the tonic.

George HandelGeorge Handel was known to be a German-British Baroque composer.

He was known for his anthems, operas, oratorios, organ concertos, e.t.c.

He had influences from middle-German polyphonic choral tradition and from Italian Baroque.

Learn more about Handel on https://brainly.com/question/1082978

how long does it take for a christmas tree to mature

Answers

It takes for a Christmas tree to mature

six to 10 years

which indian civilization developed some of the world’s first planned cities?

Answers

Answer:

The people of the indus valley

Explanation:

South-east Australia is very densely populated​

Answers

Answer:

Because it is all a howling desert, has no water and people hate water.

how does the behavior of curley’s wife seem deliberately designed to provoke the men?

Answers

curleys wife is touchy and flirts with other men

1.
Why did Ben Franklin not become a minister the way his parents wanted him to?
Options:
A: His parents could only afford to send him to school for two years.
B: He wanted to become a writer.
C: He wanted to be an inventor.
D: He did not believe in God.

Answers

Answer:

Instead, Ben ended up as an apprentice to his half-brother James, who was a printer. Ben loved to read and write poetry, so this job seemed as good as any. At the age of twelve he signed an indenture lasting nine years. While learning the trade from James, Ben worked on his writing, copying the style of essays he read in a copy of a magazine.

When James started a paper in 1721, called the New England Courant, Ben submitted a series of essays to the magazine under the pseudonym Silence Dogood. The essays made fun of Boston society and became very popular.

Answer:

A: His Parents could only affor to send him to school for two years.

Explanation: Benjamin's parents withdrew him from school after deciding that clergyman's training was too expensive, especially since ministers were often so poorly paid.

Hope this helps :)

what creature did harry’s class have to navigate when crossing a series of potholes?

Answers

The creatures Harry’s class had to navigate when crossing a series of

potholes were known as the red caps.

This creature are dwarf-like and found in places such as dungeons or areas

which had blood spilled.  They had red eyes and sharp nails which they

used to attack people who invaded their space.

Their existence is a myth and had other characteristics such as staining their

hat with blood during attacks on people.

Read more about Harry Potter on https://brainly.com/question/25883347

Question 1 of 15
What did people who opposed westward expansion often argue?
A. Expanding farther west would allow slavery to spread outside the
South
B. Expanding into the West would weaken the U.S. federal
government too much.
C. Settlers living in western territories had no right to join the United
States.
D. The environment in western territories was too dangerous for
settlements.

Answers

People who oppose western expansion frequently claim that doing so will encourage the spread of slavery outside of the South. Option A is correct.

What is the westward expansion?

Westward expansion is called as the 19th-century movement of settlers into the American West,  The trans-Appalachian West was home to approximately 7 million Americans by 1840, accounting for 40% of the country's total population.

Most of these individuals had left their homes in the East in quest of economic opportunities, following a road pioneered by Lewis and Clark.

Western parts of the continent that were previously unpopulated were combined to become a powerful country. New settlements were founded by the hundreds of thousands of people who migrated west.

Therefore, option A is correct.

Learn more about the westward expansion, refer to:

https://brainly.com/question/21117484

#SPJ2

Answer:

A. Expanding farther west would allow slavery to spread outside the

South

Explanation:

Just took it :)

How many years does a US representative serve in one term of office? two four six eight.

Answers

Answer:

4

Explanation:

I think that it is 4 at least I know a president is 4

The number of years that a US representative serves in one term of office is 4 years.

Representatives in the United States are allowed a period of four years in office by the constitution.

The reason why this provision was made by the founding fathers is to avoid situations where people hold on to power and establish autonomy in the country.

After four years in office they can run an election to determine the will of the majority.

Learn more about the U.S terms of office here:

https://brainly.com/question/4110824

In which situation democracy handles social diversities?What are relations between them?​

Answers

8 the answer would be approximately 7 feet layers to the ground above the awarefewt

Answer:

Democracy accommodates social diversity as it allows for equality, fair representation to all irrespective of their caste, creed, color, race, religion, language or place of residence. Skin color basically goes with race.

Explanation:

It is possible to use a decision making process for any decision. Please select the best answer from the choices provided T F.

Answers

Answer:

true

Explanation:

Do you think that children should be taught to be proud of their country?
Write an answer expressing your opinion.
In your answer you should:
• give reasons for your opinion;
• use relevant examples to support your opinion (you may use your own experience);
• show that you have considered different points of view;
• explain why you disagreed with some of these points of view.

Answers

Answer:

yes they should be taught to be proud of their country

Explanation:

Many people who are not patriotic tend to think that their country does not have the capability of helping him learn his career so he decides to go to another country only to later realize that his country had the resource and was actually betteralready gave an example in 1I have talked to many children here in my African country and they all dream to go to big cities like New York or London but don't realize that with their labour they could make their countries city bigger than that London they dream of.Children of civil servants are actually patriotic since they see their parents benefiting from their country. there are others who don't even know their country well and this is disappointing.I disagree with the parents who actually encourage their children to go to other countries so as to send a lot of money home yet they don't realize how hard it is to cope with a currency that akes your hard earned money look like spare change and later come home broke when they could have become big business men and women if they had stayed and worked

Which concept describes the idea that government and government officials are not above the law? limited government federalism rule of law guaranteed rights.

Answers

The concept of limited government states the idea that the government and government officials are not above the law. So the correct option that matches the above statement is A.

Limited government refers that the law supersedes any authority, and only the lawmaker or Supreme Court has the sole authority to make changes in the law.

Rules of law

It has been seen that there have been various cases that were filed on the government or on the working of the government offices like police authorities in which the government lost.

The concept of limited government states that the law is above all the authorities, irrespective of their position in the democracy. If a criminal wrong is punishable, it will be punishable for all.

Rule of law also states that no one including superior authorities like a President, Minister, central or state government is as good as a normal individual in the eyes of the law.

Hence, the correct option is A that the rule of Limited government states that the government and the government officials are not above the law.

To know more about Laws, refer to the link below.

https://brainly.com/question/6590381

Answer:

The answer is C: THE RULE OF LAW

Explanation:

Activity 1: Interview and older member of your family parents, uncles, aunts, cousins or grandparents). Ask him/her of a particular important decision that he/she has made using any 9/ ሰe itorial fact ot ፡1/ ሃገር ክe det'elopment of a person : ኮ! ክ ኮ oct that እr/he aus on trong en r የኔ ፡ በክ dercision Write ory ot pt n በ'እic organiይ 7. Name or the person intermed Don ma Internal factor and how arluenced the decision CL/E Outcome of the decision Lesson garned from the interview​

Answers

Many factors influence an individual's decision making, some of them are:

FamilyCultureSocietyEnvironmentReligious beliefEthnicity

What is a decision?

A decision is a term that refers to the end product of the specific mental-cognitive process of an individual or a group of people or organizations to choose one alternative over the others.

Generally, decisions are made influenced by different factors in the life of the individual or individuals who must make a decision. An example of this is:

In a situation, a person has the opportunity to classify their waste to take advantage of those that are recyclable and dispose of those that cannot be reused or recycled.

This person can make that recycling decision based on their beliefs and culture. For example, if he has always been interested in caring for the environment, he could decide to recycle. Whereas if he does not know the environmental damage of pollution, she may continue to dispose of his garbage as he normally did.

Learn more about decisions in: https://brainly.com/question/7383200

how many electoral votes does a candidate need to win the election?

Answers

Answer: 270

Explanation:

It's a long history of this.



Hannah plans to spend 1/4 of her next month's income

on rent, 1/12 on transportation, 1/6 on food, $520 on

other expenses, and save $875. How much does she plan

to spend on food?

Round up to the nearest cent

Answers

The answer is1395$ to spend food

What factors led to Viking raids on other countries?

Answers

Answer:

They needed resources that Scandinavia could not supply


What are our duties towards the nation? List them.

Answers

, some of the moral responsibilities and duties mentioned in the constitution are: We must respect the National Flag and National Anthem, obey the laws of our country, protect the power, unity and integrity of the country, safeguard public property, pay our taxes with honesty promptly, protect ...

Suppose a U.S. state legislature decided to pass a law making it mandatory for students in public schools to recite the Ten Commandments from the Christian Bible, to pass eighth grade. Who would determine if this new law was constitutional?

Answers

Answer:

Supreme court

Explanation:

Got this question on a test and got it right

Answer:

Supreme court

Explanation:

what is the immaculate conception of the blessed virgin mary

Answers

According to the gospels of Matthew and Luke in the New Testament, Mary was a first-century Jewish woman of Nazareth, the wife of Joseph, and the mother of Jesus. Both the New Testament and the Quran describe Mary as a virgin.
Born: c. 18 BC
Died: after c. 30/33 AD
Parents: Saint Anne, Joachim

Answer: Necessary for the birth of our Lord!

Explanation:

The Immaculate Conception is when Our Lady was conceived since Jesus could not be born by a woman who had original sin, because then he would have sin.

CLASSROOM ACTIVITIES 1. Which means of transport do you think is very suitable in Nepal? Organize a discussion in your class and write a report.​

Answers

Answer:

roadways are suitable to nepal

Which of the following best describes relations between colonists and American Indians in the early days of the Georgia colony?
Relations were good due to the policies of James Oglethorpe.
Relations were poor due to the policies of William Berkeley.
Relations were strained due to the Tuscarora War.
Relations improved following Bacon’s Rebellion.

Answers

The best description of relations between colonists and American Indians in the early days of the Georgia colony is relations were good due to the policies of James Oglethorpe. Thus, option A is correct.

What is colony?

Colony is defined as a group of individuals who has been leave their motherland or place of their birth to start farming in a new place or land which is connected along with their own nation.

The Georgia colony was the colonies belong to British America and it belongs to southern part of British America. The Georgia American colony was thirteen original colonies of America.

Therefore, The best description of relations between colonists and American Indians in the early days of the Georgia colony is relations were good due to the policies of James Oglethorpe. Thus, option A is correct.

Learn more about colony here:

https://brainly.com/question/385363

#SPJ1

A cultural icon can be a:

a. significance
b. representation
c. symbol
d. idea

Answers

Answer:

A cultural icon can be a symbol.

Answer:

A cultural icon can be a symbol.

Explanation:

[tex]\huge\purple{\mathbb{SiaJiwoo}}[/tex]

Other Questions
A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ