Answer
The carbon cycle is nature's way of reusing carbon atoms,
Explanation:
The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms. Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground. Some is buried and will become fossil fuels in millions and millions of years. Carbon moves from living things to the atmosphere.
ACADEMIC STUDY ON NATURAL SELECTION, THIS IS NOT A TEST!!!
PLS HELP I GIVE BRAINLIEST.
As you have learned in this lesson, arthropods are the largest phylum of animals. In this activity, you will need a notebook and a pencil or pen. You will investigate the natural surroundings of a place of your choice and search for critters in the arthropod phylum. Look under logs, rocks, in gardens, and other moist places. Each time you find one, if you know the name of it, write it down in a list. Otherwise, give it a name based upon its descriptive characteristics.
Place a tally mark next to an arthropod every time you find another of its kind, this way you can record how many of the same species you observe. Look in many different mini-habitats so you can find different types of arthropods.
Make careful observations about their body parts, the way they move, and how they respond when they notice your presence.
Answer the following questions:
Where did you find the most arthropods?
Which arthropod was most common in the areas you looked?
Which creatures did you find least often?
1. I found the most arthropods in a small forested area near a pond. There were so many different types of creatures to observe, it was incredible.
2. The most common arthropod I found was a type of beetle that had a shiny green carapace.
3. They were crawling all over the place! The creatures I found least often were a type of spider that was very small and hard to see. I only found a couple of them hiding under some leaves.
Describe the events in excitation contraction coupling
Answer:
cardiac contraction-excitation The sequence of occurrences, from the generation of an electrical impulse to the contraction of cardiac muscles, is referred to as coupling. This procedure is essential because it enables the heart to beat in a regulated manner without requiring conscious effort. With the help of EC coupling, the cardiac muscles sequentially contract, allowing blood to be pumped between 60 and 100 times per minute, first to the lungs and subsequently the rest of the body.
Explanation:
Question 16 of 25
What is gene flow?
A. Two populations transferring genes
OB. When a population splits in two
OC. Selection for extreme traits
OD. A mutation becoming more common
SUMIT
A. Two populations transferring genes is gene flow
What alters two populations due to gene flow?Gene flow has the effect of reducing genetic diversity among populations, inhibiting or delaying the development of populations in various geographic locations into distinct species of the disease.
The frequencies of alleles will fluctuate as a result of gene flow, the transfer of alleles caused by the movement of people or gametes across populations. Evolutionary change, which is frequent in natural populations, comes from deviation from any of these requirements.
Gene flow increases genetic variation when there is a continuum of alleles in the same way that a source of small-effect mutations would.
learn more about Gene flow
https://brainly.com/question/2698940
#SPJ1
what is the role of a scientist
draw a symbol that depicts the lesson draw a symbol that depicts the lesson discussed explain it by creating an acrostic poem for the word "ADOLESCENCE"
We can see here that explaining your lesson by creating an acrostic poem for the word "ADOLESCENCE," we have:
Astonishing, young minds evolving
Dreaming of brighter days in the future
Opposite of adulthood, this is a youth's chance
Learning from experiences that they may encounter
Every lesson teaches them an important trait
Seeking knowledge that will help their future traits
Cherishing each moment with close friends
Enlightening moments that will never end.
What is an acrostic poem?An acrostic poem is a type of poem in which the first letters of each line are organized to spell out a word or phrase. In an acrostic poem, each line of the poem has a connection to the word or phrase that it spells out.
We can see here that this type of poem is often used as a creative writing exercise or for a special occasion.
Learn more about acrostic poem on https://brainly.com/question/26346712
#SPJ1
If you infect the buffalo population with a disease , how do you predict that will affect the buffalo population ?
Rinderpest had been suppressing the populations, but once the vaccination program eliminated the disease in cattle, rinderpest also disappeared from Serengeti's wildlife. And that's when the buffalo and wildebeest boomed.
What happens when matter changes in size or shape only?
A) A psychical change
B) A chemical change
answer
A psychical change
Jeannie was studying heredity and drew the illustration shown below.
Image
What is Jeannie showing with the dark lines inside each cell?
Anything that can be seen inside the nucleus of a cell. Proteins and DNA are organised into genes, which form a chromosome.
What are chromosomes and how many are there?Chromosomes—threadlike structures made up of protein and a single DNA molecule—are used to carry genetic information from cell to cell. Chromosomes are housed in the nucleus of cells in both plants and animals, including humans.
Each cell normally has 23 pairs of chromosomes. Chromosomes, according to Sutton and Boveri's Chromosomal Theory of Inheritance, are the means by which genetic inheritance is conveyed. Rather, chromosomal behaviour includes segregation, independent assortment, and, on rare occasions, linkage; neither Mendelian genetics nor gene linkage are completely true.
To know more about chromosome visit:
brainly.com/question/1596925
#SPJ9
If I push on the ground with my foot with a force of 140 N Backwards, what will the force pushing my skateboard be?
The force pushing your skateboard will be equal in size and the opposite of the force your foot applies to the ground, assuming there is no friction between the skateboard and the ground.
Skateboard: What is Newton's third law?Newton's first law states that unless another force acts on an item in motion, it will continue to move in the same direction and at the same pace. As long as no force is applied to a rolling skateboard, it will continue to move in the same direction and at the same pace.
What will happen if you're standing on the floor to the force of your body pressing down on it?Every action has an opposite and equal response, according to Newton's third law. You may not realize it, but when you stand on the ground, you are exerting force against the ground since gravity is pulling you down due to your weight. The floor is pushing back in response.
to know more about skateboard here:
brainly.com/question/30286828
#SPJ1
Anyone know how to solve this? It's biotechnology haha.
Based on the gel results, patient A has lower levels of the protein corresponding to standard IV in their blood.
The protein that is different in patient B is the one corresponding to the band that did not match with any of the standards. The fact that the band on the gel for patient B was smaller in size compared to the control band suggests that the protein is of smaller molecular weight than the standard.
What is the significance of the results of the protein levels for patients A and B?Since these are essential blood proteins, the difference in protein levels for both patients may have implications for their health.
For patient A, lower levels of the protein corresponding to standard IV may indicate a potential health issue related to the function of that protein.
For patient B, the difference in the size of the protein may indicate a mutation or alteration in the gene responsible for encoding that protein, which could lead to a functional difference or potential health issue. Further testing and analysis would be needed to determine the specific implications for each patient.
Learn more about protein levels at: https://brainly.com/question/29520808
#SPJ1
The stamen, pistil and petals are a part of which living thing?
Answer:
A flower
Explanation:
Which scenario describes a relationship of commensalism
In an ecological interaction known as commensalism, one creature benefits while the other is neither aided nor hurt.
When a bird builds its nest in a tree, that is an example of a commensal relationship. The bird gains from having a secure location to erect its nest, while the tree receives neither assistance nor injury. The bird's nest has no impact on the tree's ability to grow and operate correctly.
In this relationship, the tree serves the bird's needs while the tree itself is unharmed. One creature gains, while the other is neither aided nor hurt, making this a commensalism example.
To learn more about commensalism:
https://brainly.in/question/8944221
A plane is traveling 800 kph west. If the forces of lift, weight, thrust, and drag upon are in equilibrium for the whole time of the flight, what will the velocity of that plane be after three hours?
2) Table 7.1 shows the results of a study which compared the decomposition of dead D 6.0 ASSIGNMENT-2023 Use data from table 7.1 to support your answer. 2670 Compare the enzyme activity at location A with the enzyme activity at location B.
In comparing the enzyme activity of the two locations; at location A, the cellulase activity is higher than at location B, while the protease activity is slightly higher at location A.
What is the comparison of the two locations?At location A, the protease activity is 2750 µmol min-1 and the cellulase activity is 4790 µmol min-1, while at location B, the protease activity is 2670 µmol min-1 and the cellulase activity is 2500 µmol min-1.
The difference in soil pH at the two locations could be due to variations in the types of vegetation, amount of rainfall, or human activities such as pollution or acid rain deposition.
The difference in soil water content at the two locations could be due to variations in the amount of rainfall, soil drainage, or the proximity to a water source such as a river or lake.
Learn more about soil pH at: https://brainly.com/question/13941039
#SPJ1
Complete question:
Table 7.1 shows the results of a study comparing the decomposition of dead leaves at two locations A and B.
location A location B
protease activity / µmol min– 1 2750 2670
cellulase activity / µmol min–1 4790 2500
soil pH 6.0 3.5
soil water content / % 10 77
(i) Compare the enzyme activity at location A with the enzyme activity at location B
what kind of spider is this, it's on a wild daffodil. I've named it Monica.
Answer:
Long leg sac spider
Explanation:
Because it has long legs and the back looks like a sac hope this helps
Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".
What is mRNA?Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.
a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.
b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.
c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.
To highlight exons, we can use three different colors. Let's use blue for first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".
In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU
Highlighted with different colors for exons:
AUGAACCCGGGACGCGCGAUGCCCUAUU
^^^^ blue ^^ orange ^^^^ pink ^^^^
In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
Highlighted with different colors for exons:
GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
^^^^ blue ^^ orange ^^^^ pink ^^^^
To know more about mRNA, refer
https://brainly.com/question/24885193
#SPJ1
can someone please help me, i dont know how to answer this. please give me pointers
Because, the passage itself describes about the nature of greenhouse effects. The greenhouse gases are absorbed by the soil. In order to protect the sensitive plants, we are going now for the modern greenhouse method i.e. artificial method. Transparent material which is nothing but like a sheet which covers the house is contructed to oppose the greenhouse gases to protect the plants. As the heat passes, some amount of heat won't escapes to atmosphere. This results in excess heat inside and leads the plants to die. Scientists say it's better to be the natural method of greenhouse effects.
Which pair of cities is moving apart as a result of plate motion
Answer:
. London, Boston pair of cities is moving apart as a result of plate motion . London situated at the Eurasian plate and Boston in the North American plate
Explanation:
Explain Continental Drift Hypothesis (pangaea and Sea Floor Spreading (Hess)
Answer:
The Continental Drift Hypothesis, proposed by Alfred Wegener in 1912, suggests that the Earth's continents were once joined together as a single supercontinent called Pangaea. According to the hypothesis, Pangaea began to break apart around 200 million years ago and its pieces slowly drifted to their present positions over millions of years.
Wegener's theory was based on several lines of evidence, including the fit of the continents, the distribution of fossils, and the matching of rock types and mountain ranges across different continents. However, at the time, he was unable to explain the mechanism by which the continents moved.
In the 1960s, the theory of sea floor spreading was proposed by Harry Hess, which provided an explanation for the movement of the continents. Sea floor spreading is the process by which new oceanic crust is formed at mid-ocean ridges and then moves away from the ridge, carrying the continents with it.
According to the theory of sea floor spreading, the Earth's lithosphere (the rigid outer layer of the Earth) is divided into a series of tectonic plates that move slowly over the underlying mantle. As magma rises to the surface at mid-ocean ridges, it cools and solidifies to form new oceanic crust. As this new crust forms, it pushes the existing crust away from the ridge, causing the continents to move.
The evidence supporting the theory of sea floor spreading includes the distribution of magnetic stripes on the ocean floor, which suggest that the Earth's magnetic field has reversed itself many times in the past. These magnetic reversals are recorded in the rocks on either side of the mid-ocean ridges, providing evidence for the movement of the tectonic plates.
Overall, the Continental Drift Hypothesis and the theory of sea floor spreading provide a compelling explanation for the movement of the Earth's continents over millions of years.
Which part of the body contains bile an enzyme that helps down lipids
Answer:
liver
Explanation:
The liver produces bile, a solution that helps you digest fats. The gallbladder stores bile. As fatty food enters the upper portion of your small intestine (the duodenum), the gallbladder squeezes bile into the small intestine through the bile ducts.
Question to answer: Do you feel that the Mcdonaldization of society is problematic or not? Explair
What to include:
At least 5-6 sentences
Your opinion
What should I write about
Answer:
The McDonaldization of society, a term coined by George Ritzer, refers to the homogenization and standardization of society, particularly in the realm of fast food and consumerism. In my opinion, the McDonaldization of society is problematic because it promotes a culture of conformity, where individuality and diversity are devalued. It also prioritizes efficiency and predictability over quality and uniqueness. The emphasis on speed and convenience has led to the proliferation of unhealthy and unsustainable food options, contributing to public health issues and environmental degradation. Moreover, the McDonaldization of society has resulted in the exploitation of low-wage workers and the concentration of wealth and power in the hands of a few large corporations. Overall, I believe that society should strive to promote diversity, creativity, and sustainability, rather than succumbing to the homogenizing forces of McDonaldization.
Explanation:
List 5 establishments or firms related in hospitality business that uses the green supply management to cater to their costumer yet to achieve costumer satisfaction and name the items or supplies
Answer:
Explanation:
dxesrtgbm xzetfg
1 2 3 a) Supply a suitable caption for this diagram b) Give labels of the parts numbered 1, 2, and 3. c) What process takes place in these structures? d) How are these structures mentioned in question 2(a), adapted to fulfill their functions? e) Where else in the body does the process take place?
The caption for the diagram is the respiratory system
The parts labeled 1, 2, and 3 are:
bronchiolealveolialveolar sacWhat are the adaptations of the bronchiole, alveoli, and alveolar sac to their functions?The bronchioles, alveoli, and alveolar sacs are all structures within the respiratory system that are adapted to their specific functions:
Bronchioles: The bronchioles are small, branching tubes that lead from the larger bronchi to the alveoli. They have smooth muscle fibers that can contract or relax to adjust the airflow, ensuring that air is directed to where it is needed in the lungs.
Alveoli: The alveoli are small, thin-walled sacs at the end of the bronchioles where gas exchange takes place. They have a large surface area, which is achieved through the presence of many tiny air sacs. This maximizes the amount of gas exchange that can occur.
Alveolar sacs: The alveolar sacs are clusters of alveoli that are responsible for the majority of gas exchange in the lungs. They have a shape that allows them to accommodate a large volume of air, maximizing the amount of gas exchange that can occur.
Learn more about alveoli at: https://brainly.com/question/11720309
All of the following are examples of environmental mutagens except
x-rays.
viruses. (Correct)
pesticides.
sunlight.
All of the following are examples of environmental mutagens except : sunlight as it does not pollute the environment.
What is meant by environmental mutagens?Agents that can cause mutations in DNA and increase the frequency of mutations in a population is known as environmental mutagens. Examples of environmental mutagens are : x-rays, UV radiation, certain chemicals such as pesticides, and some naturally occurring substances like aflatoxins produced by fungi.
Mutagens are the substances that have the ability to change the genetic composition of a person / animal and these changes caused by mutagens are referred to as genetic mutations. Major target of mutagens is DNA.
To know more about environmental mutagens, refer
https://brainly.com/question/9628269
#SPJ1
1. Index fossils are useful tools for geologists.
A. What information can index fossils tell geologists? (4 points)
B. What are three characteristics of a good index fossil? (6 points)
Answer:
A. Index fossils are useful tools for geologists because they can provide information about the relative age of rocks and help to correlate rock formations across different locations. By identifying and dating the age of index fossils found in a particular rock layer, geologists can determine the approximate age of the rock layer and its correlation with other rock layers in the region.
B. Three characteristics of a good index fossil are:
Widespread distribution: A good index fossil should have a wide geographic distribution, which means that it should be found in multiple locations around the world. This helps to establish a correlation between different rock layers that contain the same index fossil.
Limited time range: A good index fossil should have a limited time range, meaning that it should have existed for a relatively short period. This allows geologists to narrow down the age range of the rock layer containing the fossil.
Easily recognizable: A good index fossil should be easily recognizable, even in small or fragmented pieces. This allows geologists to quickly identify and date the fossil, even if only a small portion of it is present in the rock layer.
Overall, a good index fossil should be distinctive, easily recognizable, have a wide distribution, and a limited time range, all of which can provide useful information for geologists studying the history of the Earth.
Explanation:
Data that is observable and non numerical
Answer:
Observable and non-numerical data is typically referred to as qualitative data. This type of data can be descriptive or categorical and is often collected through interviews, surveys, or observations. Examples of qualitative data include the color of a flower, the texture of a fabric, or the opinions expressed by individuals in a focus group.
Explanation:
The volume of Uranus is less than one-tenth of the volume of Saturn.
(the subject does not so the science I needed so I just put biology)
The volume of Uranus is less than one-tenth of the volume of Saturn. This assertion is accurate.
What are the distinctions between Saturn and Uranus?Despite having a smaller mass, Uranus has a slightly larger diameter than its neighbor, Neptune. Saturn is the least dense planet, making it the second least dense after that. The methane gas in Uranus' atmosphere gives the planet its bluish-green hue. The cloud tops of Uranus reflect sunlight back out of the atmosphere as it passes through them.
How similar are Saturn and Uranus?Similarities Between Saturn and Uranus: The atmospheres of both planets are primarily made of hydrogen and helium. Each planet revolves around the Sun. Both have a core that is hotter. They both have several moons.
To learn more about volume of planets visit:
brainly.com/question/16357823
#SPJ1
If having 8 repeats at loci 1 is found in 10 % of the US population, having 12 repeats at loci 2 is found in 5% of the US population, having 7 repeats at loci 3 is found in 10% of the US population, and having 5 repeats at loci 4 is found in 30% of the US population, if the US has a population of 300 million people, how many people in the US would have this DNA profile at those 4 loci?
This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci.
What is DNA?DNA (Deoxyribonucleic acid) is a long, complex molecule that contains the genetic instructions used in the development and function of all known living organisms and many viruses. It is often described as the "blueprint" or "code" of life. DNA is composed of four types of nucleotides, which are the building blocks of the DNA molecule. Each nucleotide contains a sugar molecule, a phosphate group, and a nitrogenous base (adenine, thymine, guanine, or cytosine). The sequence of these bases along the DNA molecule determines the genetic information it carries.
Here,
To determine the number of individuals in the US population that have a specific DNA profile at these four loci, we need to multiply the percentage of individuals with each genotype at each loci. Let's start by finding the number of individuals in the US population who have 8 repeats at loci 1. We know that 10% of the US population has this genotype, so:
Number of individuals with 8 repeats at loci 1 = 10% of 300 million
= 0.1 x 300,000,000
= 30,000,000
Similarly, we can find the number of individuals with 12 repeats at loci 2:
Number of individuals with 12 repeats at loci 2 = 5% of 300 million
= 0.05 x 300,000,000
= 15,000,000
For loci 3:
Number of individuals with 7 repeats at loci 3 = 10% of 300 million
= 0.1 x 300,000,000
= 30,000,000
And finally, for loci 4:
Number of individuals with 5 repeats at loci 4 = 30% of 300 million
= 0.3 x 300,000,000
= 90,000,000
To find the number of individuals with all four of these genotypes, we need to multiply these four values:
Number of individuals with all four genotypes = 30,000,000 x 15,000,000 x 30,000,000 x 90,000,000
= 3.87 x 10²⁵
This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci. In practice, forensic DNA profiling typically looks at many more loci to increase the uniqueness of the DNA profile.
To know more about DNA,
https://brainly.com/question/30396067
#SPJ9
An investigator studies the amount of alcohol produced by yeast when it is incubated with different types of sugars.
What would be Control treatment:
The experiment's controls include the amount of alcohol present, the incubation environment, and the varieties of yeast utilized.
how alcohol affects the body?Digestion issues, liver illness, high cholesterol levels, heart disease, and stroke. Cancer of the rectum, liver, colon, mouth, throat, esophagus, and breast. Immune system deterioration increases the likelihood of getting sick. issues with memory and learning, including dementia, and low academic achievement.
Alcohol – a healthy beverage?Many short- & long-term health hazards, including as blood pressure problems, violent crime, risky sexual behavior, and different malignancies, are linked to alcohol usage. The likelihood of these negative effects grows as your alcohol consumption does.
To know more about Alchohol visit:
https://brainly.com/question/11908844
#SPJ1