Choose the best spanish equivalent to the phrase. We should comb our hair.

Answers

Answer 1

The sentence We should comb our hair is equivalent to the sentence Nosotros debemos peinar nuestro cabello.

In this question we should translate a sentence in English into Spanish, in this case a literal manner based on Spanish grammar and conserving the grammatical construction of the English original is used for a better understanding of the reader.

ProcedureGrammatical structure

We know that the grammatical structure is described below:

Pronoun + auxiliary verb + verb + complement

Translation

Based on these rules, we have the following translation:

Nosotros debemos peinar nuestro cabello.

Conclusion

In a nutshell, the sentence We should comb our hair is equivalent to the sentence Nosotros debemos peinar nuestro cabello.

To learn more on sentences in Spanish, we kindly invite to check this verified question: https://brainly.com/question/11727612

Answer 2

Answer:

Debemos Peirnarnos

D on Edge

Explanation:


Related Questions

When practicing rational emotive behavior therapy, a therapist will typically.

Answers

Answer: huh?

Explanation:

Examine the logic the client uses that leads him or her to the emotional reaction. Therefore, the correct answer is option D.

Explanation: When practicing Rational Emotive Behavior Therapy, a therapist works to examine the logic or reasoning the client uses that leads to the emotional reaction they experience. This involves helping the client to understand how their thoughts and beliefs may be causing negative feelings, or helping them reinterpret their experiences to get new perspectives. The therapist can also explore potential causes of the problem that the client may be unaware of, and help them to recognize negative patterns of thinking and behavior. It does not involve looking for childhood experiences that contributed to the current problem or affirming to the client that they have good reasons to feel the way they do.

Therefore, the correct answer is option D.

Learn more about the rational emotive behavior therapy here:

https://brainly.com/question/32749208.

#SPJ6

"Your question is incomplete, probably the complete question/missing part is:"

When practicing rational emotive behavior therapy, a therapist will typically a. look for the childhood experiences that contributed to the current problem.

b. affirm to the client that he or she has good reasons to feel the way he or she does.

c. wait for the client to discover the source of the problem rather than suggest what the source might be.

d. examine the logic the client uses that leads him or her to the emotional reaction.

the table below shows the ages of houses to the nearest year in a neighborhood. using the age of the houses as the random variable, x, which graph shows the probability distribution, px(x), of a randomly chosen house?

Answers

Probability distributions are used to represent data and their probabilities

The table entry is given as:

Age of House      Number of Houses

1                                         15

2                                        20

3                                         25

4                                        30

Start by calculating the probability of selecting a house that has a certain age.

This is calculated as:

[tex]Pr =\frac{Number\ of\ house}{Total\ number\ of\ house}[/tex]

So, we have:

[tex]P(1) = \frac{15}{90} = 0.17[/tex]

[tex]P(2) = \frac{20}{90} = 0.22[/tex]

[tex]P(3) = \frac{25}{90} = 0.28[/tex]

[tex]P(4) = \frac{30}{90} = 0.33[/tex]

This means that the graph that represents the probability distribution must show that the probability of 1 is 0.17; 2 is 0.22; 3 is 0.28; 4 is 0.33.

Read more about probability distribution at:

https://brainly.com/question/9385303

Answer:

a on edge

Explanation:

welcome

Which fossils are formed by sediments and found in sedimentary rock.

Answers

The answer is petrified fossils

The free body diagram below shows the forces acting on a bicycle.

Answers

Answer:

I need only 5 brainlisted please give me

Explanation:

please understand my situation

Read this sentence from the paragraph on page 3 of passage 2.

Answers

Answer:

Sentence? Is there a picture that comes with this?

Emma puts $10,000 in a simple interest account at a bank. She will earn $1,800 in 4 years. What is the annual interest rate for the account?.

Answers

Answer: 4.5%

Explanation:

A = P(1 + rt)

A = final amount

P = initial principal balance

r = annual interest rate

t = time (in years)

A = 10000 + 1800 = 11800

11800 = 10000 (1 + r4)

1.18 = 1 + 4r

4r = 0.18

r = 0.18/4 = 0.045 = 4.5%

The required annual interest rate is  4.5% for the account.

What is the simple interest?

Simple interest is defined as interest paid on the original principal and calculated with the following formula:

S.I. = P × R × T, where P = Principal, R = Rate of Interest in % per annum, and T = Time, usually calculated as the number of years. The rate of interest is in percentage r% and is to be written as r/100.

A = P(1 + rt) ...(i)

First, we have to find the final amount

Initial principal amount (P) =  $10,000

Time (t in years) = 4

A = P + S.I.

A = 10000 + 1800 = 11800

Substitute the values in the above formula (i),

11800 = 10000 (1 + r × 4)

1.18 = 1 + 4r

4r = 0.18

r = 0.18/4 = 0.045 = 4.5%

Therefore, the required annual interest rate is  4.5% for the account.

Learn more about the simple interest here:

brainly.com/question/22621039

#SPJ5

During development individual cells of the same organism begin to produce different proteins because.

Answers

Answer:

The cell types in a multicellular organism become different from one another because they synthesize and accumulate different sets of RNA and protein molecules. They generally do this without altering the sequence of their DNA.

Along what waterway did abraham begin his wanderings away from his native city?.

Answers

Answer:The Euphrates river

On kyle thomason's $400,000. 00 loan, the lender charges a 2-point service charge. In this situation, how much will kyle have to pay for this service charge at closing, and how would such a charge appear on the statement?.

Answers

Answer: sorry the correct answer is $8,000

Explanation:400,000 x .2% =$8.000 debit to the buyer

Disheartened about the team's prospects in the tournament after injuries to the two leading scorers, kenji nevertheless tried to be when he talked with his teammates.

Answers

Disheartened about the team's prospects in the tournament after injuries to

the two leading scorers, Kenji nevertheless tried to be optimistic when he

talked with his teammates.

Optimistic means an individual having a feeling of hope and confidence

about a particular occurrence. This mostly occurs when the conditions aren't

favorable.

In this case, there were injuries to the two leading scorers which made him

still hopeful of them winning the tournament despite the unfavorable

condition.

Read more about Optimistic here https://brainly.com/question/19563572

In the middle of our sleep a burglar broke in our house.

Answers

The question requires that we identify the past continuous form of the sentence. The answer to the question will be:

When we were in the middle of our sleep, a burglar broke into our house.

The past continuous form of a sentence describes an action that started sometime in the past and continued for a while after it began.

The sentence above describes a past continuous sentence because it described an action that was ongoing sometime in the past.

Learn more about the past continuous sentence here:

https://brainly.com/question/14025107

Ethan rolls a 6-sided number cube. What is the probability that he gets a number greater than 2?.

Answers

a 66.7% chance :))) Hope this helps

Answer: the other person is right, just the FRACTION form is 2/3 which is what is needed for A P E X

Explanation:

A polynomial function with a leading coefficient of 1 and multiplicity 1 for each factor has the following roots: x-2 x-(1+mc001-1. Jpg x+3i another factor of the polynomial is: x+2 x-(1-mc001-2. Jpg) x-mc001-3. Jpg.

Answers

The total number of factors that the polynomial above have is 4. Check more about the polynomial below:

What is a  polynomial function?

This is known to be a  function that entails only non-negative integer powers  or that has only positive integer exponents of a given variable.

In a polynomial, there is a factor known as the leading term, which is the term that has the highest power of x.

Conclusively, Note that  polynomial that has 4 factors is referred to as Quartic Polynomial and an example is 6x4+3x3+3x2+2x+1. The polynomial function will be f(x) = (x + 2i)(x + 3i)(x - 2i)(x - 3i).

Learn more about polynomial  from

https://brainly.com/question/2833285

Explain one example of why nationalism thrived in the period c. 1750-c. 1900.

Answers

Nationalism flourished between 1750 and 1900 because during this time nations were establishing and strengthening themselves internally as homogeneous groups with a common culture.

What is nationalism?

Nationalism is a term to refer to a sociopolitical ideology that emerged together with the modern concept of the nation that characterized different historical events such as:

Age of the Revolutions.Independence movements of the European colonies in America.

Nationalism is based on a higher level of awareness and identification with the reality and history of a nation, that is, it is based on the belief that there are certain characteristics common to a national community that must be legitimized and politically modeled.

This ideology was very successful from the middle of the 18th century because from that time there was a transition between the kingdoms and the Middle Ages to the modern age and the conformation of the modern states.

Learn more about nationalism in: https://brainly.com/question/1018147

Answer:

Nationalism thrived in 1750-1900 because during that period people began to realize nationalist aspirations. The French revolution inspired people all over Europe, the revolution spread ideas of liberty, equality, fraternity, and the overall spirit of nationalism.

The ratio between the amounts of muscle on your body to the amount of fat on your body is called.

Answers

Answer:

The ratio between the amount of muscle on your body to the amount of fat on your body is called. Body composition

According to the graph, approximately how much of the us population used the internet in 2006? less than 20% about 40% about 70% more than 80%.

Answers

Answer:70%

Explanation:

C

“Finding information” tops the list of the most common reasons individuals use the internet, with nearly six in ten (58.4%) people globally citing it as such. Keeping in touch with friends and family comes in second place with 54.2 percent. Thus, option C is correct.

What US population used the internet in 2006?

Despite these advancements, the Report determines that 19 million Americans, or 6% of the population, still do not have access to fixed broadband service at threshold speeds. 14.5 million individuals, or close to one-fourth of the population, do not have access to this service in rural areas.

In America as a whole, 42% of adults had access to high-speed internet at home as of March 2006. Thirty percent of all adults accessed high-speed internet at home in March 2005. A rise in internet penetration from 66% to 73% over the previous year has contributed to this development in broadband adoption.

Therefore, According to the graph, approximately 70% US population used the internet in 2006.

Learn more about internet here:

https://brainly.com/question/13742250

#SPJ5

Read the passage from animal farm. And the behaviour of the cat was somewhat peculiar. It was soon noticed that when there was work to be done the cat could never be found. She would vanish for hours on end, and then reappear at meal-times, or in the evening after work was over, as though nothing had happened. But she always made such excellent excuses, and purred so affectionately, that it was impossible not to believe in her good intentions. What is the central idea of this passage?.

Answers

Answer:

The central idea of this passage is that the cat is lazy and manipulative. She doesn't work, but her cunningness and cuteness allow her consistent privileges.

Answer:the cat is lazy

Explanation: im off crack so i know n stuff

Which line in daliah’s campaign speech best supports her claims that reading is beneficial to learning?.

Answers

The lines that best support her claims are:

Research also shows that the more we read, the more we learn about different cultures. Research shows that the more access students have to books, the more student achievement improves on state and district assessments.

As you included no options, the two best answers from the text are above.

Learning by reading

By explicitly mentioning that reading helps us learn more about other cultures, Deliah is saying that when one reads, they can learn.

Deliah also notes that when one has more access to books, they can do better in school. This means that the more a student reads, the better chance they stand of leaning such that they excel at school.

In conclusion, reading helps us learn.

Find out more about the importance of reading at https://brainly.com/question/24377923.

Answer:

however, research shows that the more access students have to books, the more student achievement improves on state and district assessments.

Explanation:

An example of innovative thinking is changing an old manufacturing process to save time and money.

Answers

Answer:

Coooool do drugs

Explanation:

A measure of the average value of a random variable is called.

Answers

Answer:

The mean can be regarded as a measure of `central location' of a random variable. It is the weighted average of the values that X can take, with weights provided by the probability distribution. The mean is also sometimes called the expected value or expectation of X and denoted by E(X).

Which of the following impacts the heat level of a pepper?

Answers

Answer:Capsaicin.

Explanation:

Reread the following quotation from paragraph 75: "oh god! to hear the insect on the leaf pronouncing on the too much life among his hungry brothers in the dust!" which of the following best states what this quote reveals about the ghost of christmas present's and scrooge's differing points of view?.

Answers

There are different kinds of quotes. The option that best state what this quote reveals about the Ghost of Christmas Present’s and Scrooge’s differing points of view is;

It suggests that the spirit believes Scrooge is oblivious to his own suffering, like an insect that does not know what lies beyond its small environment.

The Ghost of Christmas Present is known to be a fictional story about a Christmas Spirits who visited Ebenezer Scrooge in the 1843. The aim was to offer him an opportunity for redemption.

People sometimes do not know what they are passing through. Scrooge wanted a change and as such was visited by three spirits. They made him realize things he had forgotten about himself.

See full question below

Reread the following quotation from paragraph 75: “Oh God! to hear the Insect on the leaf pronouncing on the too much life among his hungry brothers in the dust!” Which of the following best states what this quote reveals about the Ghost of Christmas Present’s and Scrooge’s differing points of view?

A. This reveals the spirit’s low opinion of Scrooge, who has a high opinion of his  own status.

B. This reveals the spirit considers Scrooge and other humans to be insects in  comparison to his power and wisdom.

C. This quote suggests that the spirit believes Scrooge is oblivious to his own  suffering, like an insect that does not know what lies beyond its small

environment.

D. This quote recalls Scrooge’s earlier words in favor of the poor dying off to lower  the population; the spirit puts Scrooge in his place, revealing that while Scrooge  may consider himself above others, the spirit knows to value the lives of other  Beings.

Learn more about this passage from

https://brainly.com/question/19854953

As the hr director of your company, you are interested in comparing the effects of strength training, aerobic training, and yoga on decreasing rates of injury and absenteeism. Your company has 9 stores with roughly the same number of employees, and you randomly assign 3 stores to participate in strength training, 3 to aerobic training, and 3 to yoga. Your alternative hypothesis is.

Answers

Based on the information given, the alternative hypothesis will be that the observed variables have different effects on the decreasing rates of injury and absenteeism.

It should be noted that the alternative hypothesis suggests a statistical difference between the observed variables.

The question is about the effects of strength training, aerobic training, and yoga on decreasing rates of injury and absenteeism. In this case, the alternative hypothesis will be that the observed variables have different effects on the decreasing rates of injury and absenteeism.

Learn more about hypothesis on:

https://brainly.com/question/16931413

All of the following were colonized by france except.

Answers

Answer:

A. Vanuatu

B. French guiana

Which of the following details from the passage best helps the reader picture the setting.

Answers

Answer:

Can u please out a pic of the Passage so I can solve ur question?

What development made exploration to africa easier for europeans.

Answers

Answer:

discover of snow on mount Kilimanjaro

Which graph below would match the situation described? a car travelling at 23 mi/h accelerates to 45 mi/h in 5 seconds. It maintains that speed for the next 5 seconds, and then slows to a stop during the next 5 seconds.

Answers

If a car travels at 23 mi/h accelerates to 45 mi/h in 5seconds, the acceleration of the car is expressed as:

a = v-u/t

u is the initial velocitya is the accelerationt is the time

a = 45-23/0.001388

a = 15,850.14mi/hr²

For the graph, the initial velocity will be 23mi/hr. The body will maintain a constant velocity for 5 seconds before decelerating for 5 secs. The required graph is as shown:

Learn more on velocity-time graph here: https://brainly.com/question/4710544

Listen to the audio and then answer the following question. Feel free to listen to the audio as many times as necessary before answering the question. What are the family plans for sunday evening?.

Answers

Answer:

gathering with relative and friends

A rectangular plot of land is 0. 4 kilometer long and 0. 07 kilometer wide. What is its area in square kilometers?.

Answers

We are given –

Length of rectangular is = 0.4 kmBreadth of rectangular = 0.07 km

We are asked to find out the are in square kilometers. As we know –

Area of rectangular plot = Length × Breadth

Area of rectangular plot = 0.4 km × 0.07km

Area of rectangular plot = 0.028 square km

Henceforth, are of rectangular plot is 0.028 square km.

________________________________

Two glucose solutions of different concentrations are placed next to each other but are separated by a semi permeable membrane. Which of the following will occur?.

Answers

There are different kinds of Chemical reaction. What will occur is that a lot of water molecules will move from x to y decreasing the concentration gradient of sucrose.

The solution above (Image inserted) will tend to move down the concentration gradient.  That is, the water molecules will move done from the area of more water to area of less water.

Osmosis is known to be a chemical situation, where solvent molecules often water move or diffuse via a semipermeable membranes.

This is usually done in regions of low solute concentration to regions of high solute concentration until both sides are equal in concentration of solutes.  The solution is said to be water moving from a hypotonic solution to the hypertonic solution.

Learn more about Osmosis from

https://brainly.com/question/9640413

Other Questions
what is 9x-4y if x= -7 and y= -6 during a science lab, Carina measured the mass of an object to be 23.4 grams. the actual mass turned out to be 22.5 grams. What was the percent error in Carina's measurement? The computer monitor to the right has a length of 44 inches anda width of 38 inches. Find the length of the diagonal. Round youranswer to the nearest hundredth. The police___ that the children died in an accidenta. believes c. believeb. is to believe d. are believing Gravitational force acts on all object in proportion to their masses. Why then, a heavy object does not fall faster than a light object? Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Blair worked for 4 2/5 hours and earned $36.30. How much would she earn if she worked for 5 4/5 hours? Enter your answer in the box.PLEASE HELP ASAPPPPP!!! I WILL GIVE BRAINLIEST AND 50 POINTS!!! PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3-