Display a data table without legend keys
A. Click on the data table and a + icon labeled chart elements will pop up
B. Check the desired box and hover over it
C. Uncheck legend keys

Answers

Answer 1

To display a data table without legend keys in a chart created in Microsoft Excel, follow these steps:

Click on the data table in the chart to select it.

Look for the "Chart Elements" button that appears at the top right corner of the chart.

Click on the "Chart Elements" button and a dropdown menu will appear.

Scroll down the menu and locate the "Legend" checkbox. Check the box and hover over it to reveal more options.

Uncheck the "Legend Keys" option to remove the legend keys from the data table.

After following these steps, the data table in the chart will be displayed without legend keys. This can help to simplify the chart and make it easier to read, especially when the legend keys are not necessary for understanding the data being presented.

Learn more about Excel at:

https://brainly.com/question/29280920

#SPJ11


Related Questions

Which of the following utilities checks the disk for bad clusters? a. fdisk b. format c. chkdsk d. defrag.

Answers

The utility that checks the disk for bad clusters is c. chkdsk.

The "chkdsk" utility, which stands for "check disk," is a command-line tool available in various operating systems, including Windows. Its primary function is to scan the file system and check for errors, including bad clusters, on a disk. When run, chkdsk analyzes the disk's structure, verifies the integrity of files and directories, and identifies and marks any bad sectors or clusters on the disk.

The "fdisk" utility is used for disk partitioning and management, not specifically for checking bad clusters. The "format" utility is used to prepare a disk or drive for use by creating a file system, but it doesn't specifically target bad clusters. The "defrag" utility, short for "defragmentation," optimizes file placement on a disk for improved performance, but it doesn't directly check for bad clusters.

Therefore, of the options given, "chkdsk" is the utility that specifically checks the disk for bad clusters.

learn more about "performance":- https://brainly.com/question/27953070

#SPJ11

memory can only perform the read operation. group of answer choices true false

Answers

The given statement "memory can only perform the read operation." is False because Memory can perform both read and write operations. In computer architecture, memory refers to the electronic components used for storing and retrieving data.

Memory is essential for any computer system as it provides a means to store data and instructions that are necessary for the execution of programs and applications. Memory can be divided into two categories - volatile and non-volatile.

Volatile memory refers to the temporary storage of data that is lost when the power supply is switched off. Examples of volatile memory include RAM (Random Access Memory) and cache memory. These types of memory allow both read and write operations, and are used for the temporary storage of data and instructions during program execution.

Non-volatile memory, on the other hand, refers to the permanent storage of data that is retained even when the power supply is switched off. Examples of non-volatile memory include ROM (Read-Only Memory), flash memory, and hard disk drives. These types of memory also allow both read and write operations, and are used for the permanent storage of data and instructions.

Therefore, it is not accurate to say that memory can only perform the read operation, as memory plays a crucial role in both read and write operations in any computer system.

For more such questions on Memory

https://brainly.com/question/28483224

#SPJ11

bits of data travel inside the processor on the

Answers

bits of data travel inside the processor on the data bus.

The data bus is a communication pathway within a processor that allows the transfer of bits of data between different components and registers. It serves as a conduit for data movement between the various units within the processor, such as the arithmetic logic unit (ALU), memory, and registers. The width of the data bus determines the number of bits that can be transferred simultaneously.

When instructions are executed, data is fetched from memory or registers and transferred along the data bus to the appropriate processing units for computation or storage. Likewise, the results of computations or data retrieval are transferred back along the data bus to the appropriate destinations.

The data bus plays a crucial role in facilitating efficient and fast data transfer within the processor, contributing to overall system performance.

learn more about "processor":- https://brainly.com/question/614196

#SPJ11

Staff Skill Project Booking (staffNo, name, dept, skillCode) (skillCode, description, chargeOutRate) (projectNo, startDate, endDate, budget, project Manager StaffNo) (staffNo, projectNo, date WorkedOn, time WorkedOn) where: Staff Skill contains staff details and staffNo is the key. contains descriptions of skill (e.g. Programmer, Analyst, Manager, etc.) and the charge out rate per hour for that skill; the key is skillCode contains project details and projectNo is the key. contains details of the date and the number of hours that a member of staff worked on a project; the key is staffNo/projectNo. Project Booking Formulate the following queries using SQL: (a) (1) List all information of the skills with a charge out rate greater than $60 per hour, in alphabetical order of description. (3%) (2) List all information of the staff with the skill description Programmer' who work in the 'Special Projects' department. (4%) (3) For all projects that were started since July 1995, list the staff name, project number and the date and number of hours worked on the project, ordered by staff name, within staff name by the project number and within project number by date. (6%) (4) How many staff have the skill 'Programmer"? (5%) (5) List all projects that have at least two staff booking to it. Display the project number and the number of bookings for this project. (6%) (6) List the average charge out rate for all skills. (2%)

Answers

The Structured Query Language (SQL) is a programming language and  SQL queries for the given scenarios 1-5 is given in the image attached.

What is the Staff Skill Project  queries about?

Structured Query Language (SQL) as a programming language, is one specifically developed to handle and maintain data stored in a relational database management system, as well as for streamlining relational data processing in a data stream management system.

For the first one, the statement retrieves all fields from the "Staff_Skill" table where the "chargeOutRate" value exceeds 60. The outcome is arranged in alphabetic sequence based on the "description" column.

Learn more about queries from

https://brainly.com/question/30622425

#SPJ1

show how acls and c-lists are derived from an access control matrix. in particular, for the following access control matrix in a published research paper, list the acls and c-lists you can derive

Answers

An access control matrix (ACM) is a table that represents the access rights for different users to various objects in a system.

An ACL (Access Control List) is a list of access control entries that specify the access rights for a particular user or group of users to a specific object. A C-list (Capability List) is a list of access control entries that specify the access rights of a particular object to a specific user or group of users.

To derive the ACLs and C-lists from an access control matrix, we need to examine each row of the matrix and identify the access rights that correspond to each user or group of users for each object. The resulting ACLs and C-lists will list the specific access rights for each user or group of users to each object.

For the following access control matrix in a published research paper:

Object A Object B Object C

User 1 read read write

User 2 read write read

User 3 write read read

We can derive the following ACLs and C-lists:

ACL for User 1:

Object A: read

Object B: read

Object C: write

ACL for User 2:

Object A: read

Object B: write

Object C: read

ACL for User 3:

Object A: write

Object B: read

Object C: read

C-list for Object A:

User 1: read

User 2: read

User 3: write

C-list for Object B:

User 1: read

User 2: write

User 3: read

C-list for Object C:

User 1: write

User 2: read

User 3: read

Visit here to learn more about access control matrix:

brainly.com/question/31956684

#SPJ11

Dijkstra’s algorithm for shortest path and prim’s minimum spanning tree algorithm both require addition memory spaces. T/F

Answers

True. Both Dijkstra's algorithm for finding the shortest path and Prim's algorithm for finding the minimum spanning tree require additional memory spaces.

Dijkstra's algorithm uses additional data structures such as a priority queue (e.g., min-heap) and a data structure to keep track of distances or costs from the source node to other nodes. These data structures help in selecting the next node with the minimum distance and maintaining the distances during the algorithm's execution.Similarly, Prim's algorithm requires extra memory space to keep track of the vertices in the minimum spanning tree and their connections. This can be achieved using data structures like an array, a priority queue, or other suitable data structures.Both algorithms rely on these additional memory spaces to efficiently process and store the necessary information for their respective calculations and selections.

Learn more about memory spaces here:

https://brainly.com/question/31042163

#SPJ11

5. Cloud-based storage such as drive and box has led to a decline in hard drive and flash drive sales. This is an example of

Answers

Cloud-based storage such as drive and box  is an example of  Disruptive technology.

What is  Cloud-based storage?

Data storage and accessibility have undergone a revolutionary transformation with the advent of cloud-based storage solutions such as Go//ogle Drive and Box.

Cloud storage is a service offered by a provider of cloud services who maintain vast data centers in various locations globally for storing and managing data.

They have reduced the need for customary physical storage devices, such as hard drives and flash drives, by offering internet-based storage solutions that are user-friendly, safe, and expandable. The sales of these tangible storage devices have dwindled due to this outcome.

Learn more about Disruptive technology  from

https://brainly.com/question/13041713

#SPJ1

given a c project (in zip file) with some supporting routines included, write the code to balance the binary tree. hint: that method begins about li

Answers

To balance a binary tree, you can use a variety of algorithms such as AVL tree, Red-Black tree, or B-tree. These algorithms maintain certain properties that ensure the tree remains balanced.

For example, in an AVL tree, you can implement a method called "balance" that checks the balance factor of each node in the tree. If the balance factor of a node is greater than 1 or less than -1, it indicates an imbalance. To balance the tree, you can perform rotation operations such as left rotation, right rotation, or double rotation.

The specific implementation details and code may vary depending on the chosen balancing algorithm and the structure of the provided C project. It is recommended to refer to relevant documentation or textbooks on binary tree balancing algorithms and adapt the code accordingly to balance the binary tree in the given project.

To learn more about  binary tree click here

brainly.com/question/13152677

#SPJ11

The method(s) with signature(s) defined in the Iterator interface is/are:
Group of answer choices
iterator
hasNext, next, and remove
add, set, get, indexOf, remove
iterate, forEach
more, continue

Answers

The method(s) with signature(s) defined in the Iterator interface is/are: hasNext, next, and remove.

The Iterator interface in Java defines three methods:

hasNext(): This method returns a boolean value indicating whether there are more elements to iterate over.

next(): This method returns the next element in the iteration sequence.

remove(): This method removes the last element returned by the iterator from the underlying collection (optional operation).

These methods allow for traversing and manipulating elements in a collection using an Iterator object.

Learn more about Iterator interface, here:

https://brainly.com/question/14235253

#SPJ1

why should a radiograph of the lumbar vertebrae be well collimated

Answers

A radiograph of the lumbar vertebrae should be well collimated for several reasons:

1.Reduced radiation exposure: Collimation helps limit the area of exposure to only the region of interest (the lumbar vertebrae). By restricting the radiation field, unnecessary radiation exposure to surrounding areas and other parts of the body is minimized, which is important for patient safety. 2. Improved image quality: Collimation helps to reduce scatter radiation, which can negatively affect the clarity and quality of the radiographic image. By narrowing the radiation beam to the specific area of interest, the resulting image will have better sharpness and definition, making it easier for the radiologist to interpret. 3. Increased diagnostic accuracy: Clear and well-collimated radiographs allow for better visualization of the lumbar vertebrae, including the intervertebral spaces, vertebral bodies, and other structures.  4. Better comparison and follow-up: Well-collimated radiographs enable easier comparison with previous images, particularly in cases of monitoring disease progression or treatment effectiveness. Overall, proper collimation in lumbar vertebrae radiographs enhances radiation safety, image quality, diagnostic accuracy, and facilitates effective comparison and follow-up.

Learn more about radiography here:

https://brainly.com/question/28869145

#SPJ11

to have your macros available when creating additional workbooks, you should consider

Answers

To have macros available when creating additional workbooks, you should consider storing the macros in a Personal Macro Workbook.

A Personal Macro Workbook is a hidden workbook in Excel that is loaded automatically when Excel starts. It allows you to store your macros and make them available across multiple workbooks.

Here are the steps to create and use a Personal Macro Workbook:

1. Open Excel and record or create the macros you want to store.

2. Click on the "Developer" tab in the Excel ribbon. If you don't see the "Developer" tab, enable it by going to "File" -> "Options" -> "Customize Ribbon" and checking the "Developer" option.

3. In the "Code" group on the "Developer" tab, click on "Record Macro" to start recording a new macro.

4. In the "Record Macro" dialog box, select "Personal Macro Workbook" from the "Store Macro in" drop-down list. Click "OK" to start recording.

5. Perform the actions you want to record as part of the macro.

6. Stop the recording by clicking on the "Stop Recording" button in the "Code" group on the "Developer" tab.

7. Close Excel.

The Personal Macro Workbook (PERSONAL.XLSB) will be created and stored in the Excel startup folder. It will now be loaded automatically whenever Excel starts, making your macros available for use in any workbook you create or open. By using the Personal Macro Workbook, you can access your macros from any workbook, ensuring their availability for your work across different files.

learn more about Macro Workbook here:

https://brainly.com/question/30034393

#SPJ11

in the above environment and store, if we execute lettuce expression deref(y)(deref(z)) do changes occur in the memory store?

Answers

Based on the information provided, it seems that you are referring to some specific environment and store, possibly related to a programming language or framework.



However, without additional context or details about the environment and store, I cannot provide a specific answer.In general, the behavior of executing the expression deref(y)(deref(z)) depends on the semantics of the language or framework you are using, as well as the values and references stored in memory. The expression may perform operations such as dereferencing pointers or accessing values stored in variables or objects.If the expression modifies the values or references stored in memory, then changes can occur in the memory store. However, without more information about the specific environment and store, it is not possible to determine the exact impact of executing that expression.




learn more about framework here:



https://brainly.com/question/25333958



#SPJ11

which of the following is not a valid boolean algebra property? a. a · 0 = 0 b. a · 1 = a c. a 0 = a d. a a = 0

Answers

The option that is not a valid Boolean algebra property is: d. a a = 0

In boolean algebra, the property a a = 0 is not valid. The correct property is a a = a (Idempotent Law), which states that the logical AND of a boolean variable with itself is equal to the variable itself. The other options are valid boolean algebra properties: a. a · 0 = 0 (Zero Property) - The logical AND of a boolean variable with 0 always results in 0. b. a · 1 = a (Identity Property) - The logical AND of a boolean variable with 1 is equal to the variable itself. c. a 0 = 0 (Zero Property) - The logical OR of a boolean variable with 0 always results in 0. Remember that boolean algebra properties govern the behavior of logical operations in binary systems.

Learn more about Boolean algebra here:

https://brainly.com/question/31647098

#SPJ11

In general, there is more than one possible binary min heap for a set of items, depending on the order of insertion.
true/false

Answers

The statement given "In general, there is more than one possible binary min heap for a set of items, depending on the order of insertion." is false because In general, there is only one possible binary min heap for a given set of items, regardless of the order of insertion.

A binary min heap is a complete binary tree where the value of each node is smaller than or equal to the values of its child nodes. This heap property ensures that the minimum element is always located at the root of the heap.

When inserting elements into a binary min heap, they are placed at the next available position in the tree and then "bubbled up" to their correct position to maintain the heap property. The order of insertion does not affect the final structure of the heap; it only affects the order in which elements may need to be bubbled up during the insertion process.

Therefore, the statement "In general, there is more than one possible binary min heap for a set of items, depending on the order of insertion" is false. There is only one possible binary min heap for a given set of items, regardless of the order of insertion.

You can learn more about binary min heap at

https://brainly.com/question/31475180

#SPJ11

you are compiling the top 50 customers from last year. you run a query in access for customers along with an asterisk (*). what will be returned?

Answers

The query will return all columns and all rows for the top 50 customers from last year, including comprehensive details of each customer's information.

What will be returned when running a query in Access for customers with an asterisk (ˣ) included?

When running a query in Access for customers with an asterisk () included, the query will return all columns and all rows for the top 50 customers from last year.

The asterisk () is a wildcard character that represents all columns in the table. By including it in the query, Access will retrieve all available data for the specified customers.

This means that the query will fetch all fields (columns) for each customer, providing a comprehensive view of their information.

The result will include details such as customer names, addresses, contact information, and any other relevant data stored in the database for those customers.

Learn more about query

brainly.com/question/29575174

#SPJ11

FILL IN THE BLANK. _ if the study design is used to test a specific predetermined hypothesis, then it is an analytical study design.

Answers

If the study design is used to test a specific predetermined hypothesis, then it is an analytical study design.

In an analytical study design, researchers formulate a specific hypothesis or research question and design the study to test that hypothesis. This type of study design is characterized by a structured approach to data collection and analysis. Analytical studies often involve comparing groups or variables to assess relationships, associations, or causal effects.

Analytical study designs include various types such as observational studies (e.g., cohort, case-control studies) and experimental studies (e.g., randomized controlled trials). These designs aim to gather data and evidence to support or refute the predetermined hypothesis, providing insights into the relationships between variables or the effects of interventions.

Learn more about specific hypothesis here;

https://brainly.com/question/28104822

#SPJ11

You want to view the feature sets that have been enabled on a router and what type of license they use

Answers

To view the feature sets enabled on a router and the type of license they use, you can typically use the command-line interface (CLI) of the router's operating system.

The exact commands and syntax may vary depending on the router's manufacturer and operating system version. Here are some general steps:

1. Access the router's CLI interface. This is usually done through a terminal emulator program or SSH connection.

2. Log in to the router using valid administrative credentials.

3. Enter the appropriate command to view the enabled feature sets and licenses.

4. The output will provide details about the enabled features and the type of license associated with each feature set.

Learn more about feature sets here: brainly.com/question/31977311

#SPJ11

if (v, w) is the lowest weighted edge in the graph, is it true that v must be added to s before w is added to s?

Answers

No, it is not necessarily true that v must be added to s before w is added to s.

In more detail, whether v must be added to s before w depends on the specific algorithm or strategy being used to construct the graph or tree. In some algorithms, such as Prim's algorithm for minimum spanning trees, the lowest weighted edge (v, w) is selected to connect a vertex v in the existing set s to a vertex w outside of s.

In this case, v would be added to s before w. However, there may be other algorithms or scenarios where the order of adding v and w to s does not matter or follows a different logic.

It is important to consider the context and specific algorithm being used when determining the order of adding vertices to a set or constructing a graph.

The given statement does not provide sufficient information to make a definitive conclusion about the order in which v and w are added to s unless the specific algorithm or strategy is specified.

To know more about algorithm click here

brainly.com/question/32185715

#SPJ11

list three methods for keeping a virtual machine secured.

Answers

The three methods for keeping a virtual machine secured are Regularly update the virtual machine software,  Configure and enforce strong access controls, Implement network security best practices.

Regularly update the virtual machine software: Ensure that your virtual machine software and its components are up-to-date with the latest security patches and updates. This will help protect the virtual environment from known vulnerabilities and threats.
Configure and enforce strong access controls: Implement strong access controls, such as multi-factor authentication, to prevent unauthorized access to the virtual machine. Additionally, limit the number of users with administrative privileges and restrict their access based on the principle of least privilege.
Implement network security best practices: Secure the virtual machine's network connections by using firewalls, intrusion detection and prevention systems, and virtual private networks (VPNs). This will help protect the virtual environment from potential attacks originating from the host or external networks.

By following these methods, you can effectively maintain the security of your virtual machine.

To learn more about virtual machine: https://brainly.com/question/28901685

#SPJ11

Nokia’s use of electronic newsletters is an example of
a. nonverbal communication
b. impersonal communication
c. upward communicationm
d. high media richness
e. jargon

Answers

Nokia's use of electronic newsletters is an example of impersonal communication. Electronic newsletters are typically mass-distributed to a wide audience and are not personalized to individual recipients. So option b is the correct answer.

Electronic newsletters are a form of impersonal communication because they are usually sent to a large audience and lack the personal touch of a one-on-one conversation. They convey information and updates about the company and its products, without the direct interaction that is characteristic of more personal forms of communication.

Impersonal communication refers to communication that lacks personalization or individualized interaction. It often involves the dissemination of information to a broad audience without specific targeting or customization for individual recipients.

In the case of electronic newsletters, Nokia is using this form of communication to share information with a large number of people in a one-way manner.

Other options mentioned, such as nonverbal communication, upward communication, high media richness, and jargon, do not accurately describe Nokia's use of electronic newsletters in this context.

So the correct answer is option b. impersonal communication.

To learn more about Nokia: https://brainly.com/question/30465294

#SPJ11

when must a teredo node send a bubble packet?

Answers

A Teredo node must send a bubble packet when it wants to refresh the binding of its Teredo address. A bubble packet is a special type of packet used in the Teredo tunneling protocol to maintain the mapping of the Teredo IPv6 address to the corresponding IPv4 address and UDP port.

The Teredo protocol allows IPv6 connectivity for hosts behind IPv4 network infrastructure by encapsulating IPv6 packets within IPv4 packets.

To establish and maintain this communication, a Teredo node periodically sends bubble packets to its Teredo server. The bubble packet contains the Teredo IPv6 address and UDP port of the node.

By sending the bubble packet, the Teredo node informs the Teredo server that it is still active and reachable. If the server receives the bubble packet, it updates the binding information for that Teredo node, ensuring that incoming packets are correctly routed to the node's IPv4 address and port.

Sending bubble packets at regular intervals is essential to maintain the Teredo tunnel and ensure continuous connectivity between Teredo nodes and the IPv6 network.

To learn more about Teredo: https://brainly.com/question/31139103

#SPJ11

dragon trainer create a game where the user must defeat three dragons to pass the trials. use inheritance to implement the following class diagram in your program.

Answers

As an AI language model, I cannot create a program with graphics or visuals as I do not have the capability to display them.

However, I can provide an example of how the class diagram could be implemented using inheritance in C++ code:

#include <iostream>

#include <string>

#include <vector>

#include <ctime>

using namespace std;

class Dragon {

public:

   Dragon(string name, int health, int damage) {

       this->name = name;

       this->health = health;

       this->damage = damage;

   }

   virtual void attack() {

       cout << name << " attacks for " << damage << " damage!" << endl;

   }

   virtual void takeDamage(int amount) {

       health -= amount;

       if (health <= 0) {

           cout << name << " has been defeated!" << endl;

       }

   }

   virtual bool isAlive() {

       return health > 0;

   }

protected:

   string name;

   int health;

   int damage;

};

class FireDragon : public Dragon {

public:

   FireDragon() : Dragon("Fire Dragon", 50, 10) {}

   void attack() override {

       cout << name << " breathes fire for " << damage << " damage!" << endl;

   }

};

class IceDragon : public Dragon {

public:

   IceDragon() : Dragon("Ice Dragon", 40, 12) {}

   void attack() override {

       cout << name << " blasts ice for " << damage << " damage!" << endl;

   }

};

class PoisonDragon : public Dragon {

public:

   PoisonDragon() : Dragon("Poison Dragon", 60, 8) {}

   void attack() override {

       cout << name << " spits poison for " << damage << " damage!" << endl;

   }

};

int main() {

   srand(time(nullptr));

   vector<Dragon*> dragons;

   dragons.push_back(new FireDragon());

   dragons.push_back(new IceDragon());

   dragons.push_back(new PoisonDragon());

   for (int i = 0; i < dragons.size(); i++) {

       while (dragons[i]->isAlive()) {

           int damage = rand() % 20 + 1;

           dragons[i]->takeDamage(damage);

           if (dragons[i]->isAlive()) {

               dragons[i]->attack();

           }

       }

   }

   return 0;

}

In this example, we have a base Dragon class with virtual methods for attacking, taking damage, and checking if the dragon is alive. We then have three derived classes, FireDragon, IceDragon, and PoisonDragon, each with their own unique implementation of the attack method.

In the main function, we create a vector of Dragon pointers, each pointing to a new instance of one of the derived classes. We then loop through the vector, repeatedly attacking each dragon with random damage until it is defeated. This simulates the game where the user must defeat each dragon to pass the trials.

Visit here to learn more about graphics:

brainly.com/question/14191900

#SPJ11

In the Dragon Trainer game, the objective is for the user to defeat three dragons to pass the trials. To implement the game, we can utilize inheritance and the provided class diagram.

The base class, Dragon, serves as the foundation for all dragons in the game. It contains common attributes such as the dragon's name and health, as well as generic methods like attack() and defend(), which can be overridden by derived classes.

The derived classes, FireDragon, IceDragon, and WaterDragon, inherit from the Dragon class and introduce specialized attributes and methods unique to each dragon type. For example, FireDragon has a firePower attribute and overrides the attack() method to perform a fire breath attack with the specified power.

By utilizing inheritance, we can easily create instances of the dragon types and call their respective methods. This allows for a flexible and scalable design, enabling the addition of more dragon types or customization options in the future.

Overall, inheritance provides a modular and organized approach to implementing the Dragon Trainer game, allowing for code reuse, specialization, and easy expansion as the game evolves.

Learn more about expansion here: brainly.com/question/32225214

#SPJ11

a server crash occurs routinely. engineers concluded that the crashes pertain to system memory errors. which problem do the engineers conclude is impacting the systems ram?

Answers

Based on the information provided, the engineers have concluded that the system memory errors are causing the routine server crashes.

This means that there is likely a problem with the RAM (Random Access Memory) in the system. RAM is responsible for storing data that the computer or server is currently using, and if there are errors in the RAM, it can cause crashes and other issues. The engineers may need to investigate further to determine the exact cause of the RAM errors, which could be due to faulty hardware, outdated software, or other issues. Once the root cause is identified, they can take steps to fix the problem and prevent future server crashes. It's important to address this issue promptly to avoid downtime and potential data loss.

To know more about memory visit:

https://brainly.com/question/14789503

#SPJ11

most posts on microblogs have no character limit. a. true b. false

Answers

Most posts on microblogs have no character limit is option  b. false

What is the microblogs  post?

The majority of microblogs, including well-known websites such as T/wit/ter, impose a constraint on the length of each post.

This limitation promotes users to communicate brief and to-the-point messages. Keep in mind that certain microblogging platforms might have varying constraints on character count, while others may not have any constraints altogether, but they aren't as prevalent.

Learn more about microblogs   from

https://brainly.com/question/18364767

#SPJ4

Which command can be used to verify connectivity between two host devices?nslookupipconfignetstatping

Answers

The command that can be used to verify connectivity between two host devices is "ping".

Ping sends packets to the specified destination and waits for a response, indicating whether or not the destination is reachable. This command can be used to troubleshoot network connectivity issues and can provide useful information about the network performance, such as latency and packet loss.

The ping command is a simple yet powerful tool for network diagnostics, but it's important to note that not all network devices respond to ping requests, so it's not always an accurate measure of network connectivity. but it's not always a definitive measure of network performance.

To know more about ping visit:

https://brainly.com/question/30288681

#SPJ11

today’s dimms use a 64-bit data path.

Answers

Today's DIMMs (Dual Inline Memory Modules) commonly use a 64-bit data path. DIMMs are the primary form of memory used in modern computers, including desktops, laptops, and servers.

The data path refers to the number of bits that can be transferred simultaneously between the memory module and the system's memory controller.

A 64-bit data path means that the DIMM can transfer 64 bits of data in a single operation. This allows for faster and more efficient data transfer between the memory module and the rest of the system. It is worth noting that the data path width can vary depending on the specific technology and generation of DIMMs, with 64-bit being a standard configuration in many systems today.

To learn more about Data path - brainly.com/question/4544451

#SPJ11

12- which permission, when applied to a directory in the file system, will allow a user to enter the directory?

Answers

The permission required to allow a user to enter a directory in the file system is "execute" permission.

When the execute permission is granted to a directory, it allows users to access and navigate into that directory. This permission enables the user to view the contents of the directory, such as files and subdirectories, and perform actions within it, such as opening files or accessing subdirectories.

Without the execute permission, even if a user has read or write permissions on the directory, they won't be able to enter and explore its contents. To summarize, granting the execute permission on a directory enables a user to enter and interact with the files and subdirectories within it.

Learn more about file permissions here:

https://brainly.com/question/31797464

#SPJ11

Which element of film structure is typically very important in the modes of historical realism and fantasy?
Group of answer choices
a. production design
b. editing
c. cinematography
d. sound

Answers

a) The element of film structure that is typically very important in the modes of historical realism and fantasy is the production design.

Production design plays a significant role in creating the visual and aesthetic world of a film. In historical realism, the production design focuses on accurately recreating the settings, costumes, and overall visual details of a specific historical period. It aims to transport the audience to a specific time and place, ensuring authenticity and believability. In fantasy films, production design is equally crucial as it involves creating imaginative and visually stunning worlds that are often beyond reality. It encompasses designing unique and fantastical sets, costumes, props, and visual effects that help bring the fantastical elements of the story to life. While editing, cinematography, and sound also contribute to the overall impact of a film, production design plays a particularly crucial role in shaping the visual aesthetics and atmosphere of historical realism and fantasy genres.

learn more about production design here:

https://brainly.com/question/30971580

#SPJ11

Assume the following cache sizing parameters
Bytes of RAM: 220 bytes
Bytes of cache: 215 bytes
Bytes per cache line: 25 bytes
From these values calculate
Lines of RAM (bytes/bytes per line): _____________________
Lines of Cache (bytes/bytes per line): _____________________

Answers

Based on the cache sizing parameters provided, here are the calculations for Lines of RAM and Lines of Cache:

Lines of RAM (bytes/bytes per line): 2^20 bytes / 2^5 bytes = 2^(20-5) = 2^15 lines

Lines of Cache (bytes/bytes per line): 2^15 bytes / 2^5 bytes = 2^(15-5) = 2^10 lines

Your answer:
Lines of RAM: 32,768 lines
Lines of Cache: 1,024 lines

RAM (Random Access Memory) consists of memory cells organized into rows and columns, where each cell stores a bit of data. The term "lines of RAM" is not a standard phrase used in reference to RAM. However, we can discuss the basic components and organization of RAM to provide a better understanding.

RAM is typically organized into modules, and each module consists of several memory chips. Each memory chip contains multiple memory cells arranged in a matrix. The number of rows and columns in this matrix depends on the specific RAM module and its capacity.

Visit here to learn more about RAM brainly.com/question/31089400

#SPJ11

Enterprise database applications tend to have some flexibility for customization,
a. True b. False

Answers

a. True Enterprise database applications generally provide a certain degree of flexibility for customization.

These applications are designed to meet the diverse needs of various businesses and industries. They often include features and functionalities that can be tailored to specific requirements. Customization options may include modifying data structures, creating user-defined fields, defining business rules and workflows, integrating with other systems, and implementing personalized user interfaces. This flexibility allows organizations to adapt the database application to their unique processes, workflows, and data models, enhancing efficiency and supporting their specific business needs. Customization capabilities are crucial for enterprise applications to provide a scalable and adaptable solution that can cater to the evolving requirements of different organizations.

Learn more about features here: brainly.com/question/31541704

#SPJ11

Other Questions
Animals are multicellular, eukaryotic ______ which ingest their food and ______ it internally fill in the blank. a(n) _________ is often defined for a record of information. group of answer choices variable array function struct Could someone help me? people who choose not to identify a church membership are called An animals normal stroke volume is 9 mL/beat and its normal heart rate is 125 beats/min. Immediately after a hemorrhage, its heart rate increases to 161 beats/min and its stroke volume does not change. What is its new cardiac output? a. 1.45 L/min b. 0.145 L/min c. 17.9 mL/min d. 17.9 L/min e. 0.055 L/min when should you seek medical attention for digestive problems quizlet Which of the following lists only essential trace elements?a. copper, manganese, selenium, iodine, molybdenumb. iron, zinc, magnesium, iodine, seleniumc. zinc, iron, manganese, fluoride, molybdenumd. boron, copper, iodine, selenium, manganese Serena can run 6.2 meters in 1 second. How many meters can she run in 7 seconds? Use an area model. according to cmm, our social worlds are something we: During fetal development which cells give rise to primary oocytes?a. Spermatogoniab. Secondary oocytesc. Oogoniad. Granulosa cellse. Luteal cells what aseptic technique practices would be most important with this patient according to dr. mccarty, following world war ii what could colonies do to become sovereign nations? In a medical lab, Sandrine is working to isolate one element from a sample of liquid material. She uses a centrifuge, a machine with a super-fastrotating container in its center. This is an example of what applied process?OA mass and heat transferOB. ConvectionOC separationOD. Biomechanics In Python: write a python program called orfs to find all the open reading frames (orfs) in ... Question: In Python Write a Python program called orfs to find all the open reading frames (ORFs) in the in... In Python Write a Python program called orfs to find all the open reading frames (ORFs) in the input sequence. INPUT: The program will take in as input a file, which will contain any number of DNA sequences in the FASTA format: - A line beginning with a ">" is the header line for the next sequence - All lines after the header contain sequence data. - There will be any number of sequences per file. - Sequences may be split over many lines. - Sequence data may be upper or lower case. - Sequence data may contain white space, which should be ignored. Ask the user for the minimum ORF to search for. The default is 50, which means your program should print out all ORFs with at least 50 bases. OUTPUT: Print your output in FASTA format, with one header line for each ORF, followed by the DNA in the ORF. The header should be the same as the header in the input file, followed by a bar "|" followed by FRAME = POS = LEN = , where is the frame number (1-6) is the genomic position of the start of the ORF (left end is base 1) is the length of the ORF (in bases) If N = 4, 5 or 6, then P should be a negative number that indicates the position of the start of the ORF from the right end of the sequence. The DNA in the ORF should be printed out with a space between each codon, and no more than 15 codons per line. For example: >gi|1786181| Escherichia coli K-12 | FRAME = 1 POS = 5215 LEN = 138 ATG ATA AAA GGA GTA ACC TGT GAA AAA GAT GCA ATC TAT CGT ACT CGC ACT TTC CCT GGT TCT GGT CGC TCC CAT GGC AGC ACA GGC TGC GGA AAT TAC GTT AGT CCC GTC AGT AAA ATT ACA GAT AGG CGA TCG TGA Worked Example: Example Input: > sequence 1 ATGCTACCGTAGTGAG > sequence 2 AATTACTAATCAGCCCATGATCATAACATAA CTGTGTATGTCTTAGAGGACCAAACCCCCCTCCTTCC Example Output (looking for ORFs of any size not actual results, just an illustration. You can use online tools, such as ORFFinder at NCBI to check your results): > sequence 1 | FRAME = 1 POS = 1 LEN = 12 ATG CTA CCG TAG > sequence 2 | FRAME = 2 POS = 17 LEN = 15 ATG ATC ATA ACA TAA > sequence 2 | FRAME = 2 POS = 38 LEN = 9 ATG TCT TAG > sequence 2 | FRAME = 4 POS = -40 LEN = 9 ATG TTA TGA > sequence 2 | FRAME = 6 POS = -45 LEN = 15 ATG ATC ATG GGC TGA Find the equation of the tangent plane and normal line to the surface 2x2+y2+2z=3 at the point (2, 1, -3). if the cornea is damaged through trauma or disease, In the early 1950s mainstream pop was produced primarily fora. white teenagersb. a family audiencec. big band enthusiastsd. a nationwide audience .1. Given the polynomial function f(x) = 1 + 2x + 3x^2 + 4x^3 + 5x^4 a. Find the Taylor polynomial of degree 3 approximating f(x) for a near 0. b. Find the Taylor polynomial of degree 3 approximating /() for a near 1. c. Are the Taylor polynomials obtained in parts (a) and (b) the same? Explain. the slowing of clocks in strongly curved space time is known as Let f(x)=x2+5x8.What is the average rate of change from x = 2 to x = 6? Enter your answer in the box.HELp