Answer:
Overproduction refers to a situation where a population of living organisms produces more offspring than the environment can support. Carrying capacity, on the other hand, refers to the maximum number of individuals that an environment can sustain over a certain period of time.
When the population of a species exceeds the carrying capacity of the environment, there is intense competition for the limited resources such as food, water, and shelter. This competition can occur between members of the same species (intraspecific competition) or between different species (interspecific competition).
As the competition for resources increases, some individuals may not be able to access enough resources to survive and reproduce, leading to a decline in their population. The individuals with advantageous traits that help them compete for resources will be more likely to survive and pass on their genes to the next generation.
Over time, this process of competition for resources can lead to changes in the population, such as adaptations and natural selection, that help individuals survive in the environment.
Explanation:
When there are too many animals living in an environment (overproduction) for the carrying capacity (the amount of individuals that can be supported in the environment long-term), there will not be enough resources like food, water, and shelter for everyone. This leads to competition for the limited amount of resources available.
Over time competition can lead to changes in the populations. The animals that are best adapted to the environment or are most efficient at obtaining resources will be more likely to survive and pass on their traits to their offspring. This can also lead to the evolution of a new species or adaptations within a species.
A plane is traveling 800 kph west. If the forces of lift, weight, thrust, and drag upon are in equilibrium for the whole time of the flight, what will the velocity of that plane be after three hours?
Dr Lee has asked you to describe the diagnosis and risk factors of the disease to the patient. What would you tell Shino about her diagnosis
High 24-hour urine calcium levels and low vitamin D levels suggest that Shino's body is not absorbing the calcium needed to maintain bone mass. She also has a bone density scan score of -3 which is indicative of an osteoporosis diagnosis.
PLS HELP I GIVE BRAINLIEST.
As you have learned in this lesson, arthropods are the largest phylum of animals. In this activity, you will need a notebook and a pencil or pen. You will investigate the natural surroundings of a place of your choice and search for critters in the arthropod phylum. Look under logs, rocks, in gardens, and other moist places. Each time you find one, if you know the name of it, write it down in a list. Otherwise, give it a name based upon its descriptive characteristics.
Place a tally mark next to an arthropod every time you find another of its kind, this way you can record how many of the same species you observe. Look in many different mini-habitats so you can find different types of arthropods.
Make careful observations about their body parts, the way they move, and how they respond when they notice your presence.
Answer the following questions:
Where did you find the most arthropods?
Which arthropod was most common in the areas you looked?
Which creatures did you find least often?
1. I found the most arthropods in a small forested area near a pond. There were so many different types of creatures to observe, it was incredible.
2. The most common arthropod I found was a type of beetle that had a shiny green carapace.
3. They were crawling all over the place! The creatures I found least often were a type of spider that was very small and hard to see. I only found a couple of them hiding under some leaves.
Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".
What is mRNA?Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.
a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.
b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.
c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.
To highlight exons, we can use three different colors. Let's use blue for first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".
In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU
Highlighted with different colors for exons:
AUGAACCCGGGACGCGCGAUGCCCUAUU
^^^^ blue ^^ orange ^^^^ pink ^^^^
In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
Highlighted with different colors for exons:
GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA
^^^^ blue ^^ orange ^^^^ pink ^^^^
To know more about mRNA, refer
https://brainly.com/question/24885193
#SPJ1
Extraction of lipids from a tissue sample requires organic solvent because ________.
As organic solvents are readily available, they must be used for the extraction of lipids from tissue samples. Lipids are hydrophobic and can only be dissolved in organic solvents, which are inexpensive and keep the temperature low and controlled.
What is meant by organic solvents?The ability to dissolve or disperse one or more other compounds makes organic solvents a carbon-based chemical. Organic solvents may be neurotoxic, reproductively unsafe, and carcinogenic. Benzene, carbon tetrachloride, and trichloroethylene are examples of organic solvents that are carcinogenic. A few of the often used solvents are acetone, ethyl acetate, hexane, heptane, dichloromethane, methanol, ethanol, tetrahydrofuran, acetonitrile, dimethylformamide, toluene, and dimethylsulfoxide, among others. It is all natural. It is composed of the organic substance acetic acid. Yet, only 5% of vinegar is acetic acid; the remaining 95% is inorganic water. Rubing alcohol's main ingredient, isopropyl alcohol (isopropanol), which is frequently used as an organic solvent, can also be abused for intoxication purposes.To learn more anout organic solvent, refer to:
https://brainly.com/question/30716068
Jeannie was studying heredity and drew the illustration shown below.
Image
What is Jeannie showing with the dark lines inside each cell?
Anything that can be seen inside the nucleus of a cell. Proteins and DNA are organised into genes, which form a chromosome.
What are chromosomes and how many are there?Chromosomes—threadlike structures made up of protein and a single DNA molecule—are used to carry genetic information from cell to cell. Chromosomes are housed in the nucleus of cells in both plants and animals, including humans.
Each cell normally has 23 pairs of chromosomes. Chromosomes, according to Sutton and Boveri's Chromosomal Theory of Inheritance, are the means by which genetic inheritance is conveyed. Rather, chromosomal behaviour includes segregation, independent assortment, and, on rare occasions, linkage; neither Mendelian genetics nor gene linkage are completely true.
To know more about chromosome visit:
brainly.com/question/1596925
#SPJ9
The stamen, pistil and petals are a part of which living thing?
Answer:
A flower
Explanation:
1 2 3 a) Supply a suitable caption for this diagram b) Give labels of the parts numbered 1, 2, and 3. c) What process takes place in these structures? d) How are these structures mentioned in question 2(a), adapted to fulfill their functions? e) Where else in the body does the process take place?
The caption for the diagram is the respiratory system
The parts labeled 1, 2, and 3 are:
bronchiolealveolialveolar sacWhat are the adaptations of the bronchiole, alveoli, and alveolar sac to their functions?The bronchioles, alveoli, and alveolar sacs are all structures within the respiratory system that are adapted to their specific functions:
Bronchioles: The bronchioles are small, branching tubes that lead from the larger bronchi to the alveoli. They have smooth muscle fibers that can contract or relax to adjust the airflow, ensuring that air is directed to where it is needed in the lungs.
Alveoli: The alveoli are small, thin-walled sacs at the end of the bronchioles where gas exchange takes place. They have a large surface area, which is achieved through the presence of many tiny air sacs. This maximizes the amount of gas exchange that can occur.
Alveolar sacs: The alveolar sacs are clusters of alveoli that are responsible for the majority of gas exchange in the lungs. They have a shape that allows them to accommodate a large volume of air, maximizing the amount of gas exchange that can occur.
Learn more about alveoli at: https://brainly.com/question/11720309
List 5 establishments or firms related in hospitality business that uses the green supply management to cater to their costumer yet to achieve costumer satisfaction and name the items or supplies
Answer:
Explanation:
dxesrtgbm xzetfg
What model of psychology represents a popular attempt at integration
Answer:
The model of psychology that represents a popular attempt at integration is the biopsychosocial model. This model proposes that psychological and behavioral factors are influenced by biological, psychological, and social factors, and that all of these factors interact with each other to shape human behavior and mental processes. It emphasizes the importance of understanding the interplay between biological, psychological, and social factors in order to develop a comprehensive understanding of mental health and illness. This model has gained popularity in recent years as a more holistic approach to psychology that integrates multiple perspectives and areas of study.
Explanation:
The volume of Uranus is less than one-tenth of the volume of Saturn.
(the subject does not so the science I needed so I just put biology)
The volume of Uranus is less than one-tenth of the volume of Saturn. This assertion is accurate.
What are the distinctions between Saturn and Uranus?Despite having a smaller mass, Uranus has a slightly larger diameter than its neighbor, Neptune. Saturn is the least dense planet, making it the second least dense after that. The methane gas in Uranus' atmosphere gives the planet its bluish-green hue. The cloud tops of Uranus reflect sunlight back out of the atmosphere as it passes through them.
How similar are Saturn and Uranus?Similarities Between Saturn and Uranus: The atmospheres of both planets are primarily made of hydrogen and helium. Each planet revolves around the Sun. Both have a core that is hotter. They both have several moons.
To learn more about volume of planets visit:
brainly.com/question/16357823
#SPJ1
A scientist collected the following data on algal growth during an experiment: Algal Growth Rates Water Temperature (°C) Time for population to double (hours) 10 69 15 58 20 36 25 44 30 52 35 71 40 78 Which of the following conclusions could be drawn from the data? A. Algae multiply most rapidly at 20°C. B. Algae multiply most slowly at 20°C. C. Algae multiply most slowly at 10°C. D. Algae multiply most rapidly at 35°C.
Based on the data provided, the conclusion that could be drawn is that algae multiply most rapidly at 35°C.
option D
What conclusions could be drawn from the data?Looking at the data, we can see that the time for the population to double decreases as the temperature increases up until 40°C, where it reaches the lowest value of 36 hours. At 10°C, the time for population to double is 69 hours, which is the longest time of all the temperatures tested.
Therefore, we can eliminate options A and C as they suggest the opposite of what is observed in the data. Option B suggests that algae multiply most slowly at 20°C, but the data shows that algae multiply faster at this temperature than at 10°C, 25°C, and 30°C. Option D suggests that algae multiply most rapidly at 35°C.
Hence, the correct answer is that algae multiply most rapidly at 35°C.
Learn more about algae here: https://brainly.com/question/800121
#SPJ1
All of the following are examples of environmental mutagens except
x-rays.
viruses. (Correct)
pesticides.
sunlight.
All of the following are examples of environmental mutagens except : sunlight as it does not pollute the environment.
What is meant by environmental mutagens?Agents that can cause mutations in DNA and increase the frequency of mutations in a population is known as environmental mutagens. Examples of environmental mutagens are : x-rays, UV radiation, certain chemicals such as pesticides, and some naturally occurring substances like aflatoxins produced by fungi.
Mutagens are the substances that have the ability to change the genetic composition of a person / animal and these changes caused by mutagens are referred to as genetic mutations. Major target of mutagens is DNA.
To know more about environmental mutagens, refer
https://brainly.com/question/9628269
#SPJ1
8. Which process charges metamorphic rock into sedimentary ro
9. Metamorphism inches the addition of
and
to pre-existing rocks,
10. Compaction & cementation of sedmerks/forms
11. Subiecting sedimentary rocks to extreme heat & pressure forms
12. Sdfiction of molten materials forms
tocks
13. Deposition and burial of sediments forms
14, Deposited sediments may be partides of which types of rock
15. Hest & Pressure acting on igneous rocks forms
16. Solid magma forms
17.
In order to form magma, what must happen to sedimentary,
metamorphic or igneous rocks?
18. For weathering & erosion to ocour, what process will the rock
usually go through first or at the same time?
Answer:
Metamorphism does not charge metamorphic rock into sedimentary rock. Metamorphic rocks are formed from pre-existing rocks through heat and pressure, while sedimentary rocks are formed from the accumulation of sediment.
Compaction and cementation of sediments forms sedimentary rock.
Subjecting sedimentary rocks to extreme heat and pressure can form metamorphic rocks.
Solidification of molten materials forms igneous rocks.
Deposition and burial of sediments can form sedimentary rocks.
Deposited sediments may be particles of various types of rock, including igneous, metamorphic, or other sedimentary rocks.
Heat and pressure acting on igneous rocks can form metamorphic rocks.
Solidification of magma can form igneous rocks.
In order to form magma, rocks must be subjected to high temperatures and pressures, typically through the process of melting in the Earth's mantle.
For weathering and erosion to occur, the rock will usually undergo physical or chemical breakdown first, which can be caused by exposure to water, wind, or other environmental factors. This can lead to the formation of sediment that can be transported and deposited elsewhere, eventually forming sedimentary rock.
Explanation:
Data that is observable and non numerical
Answer:
Observable and non-numerical data is typically referred to as qualitative data. This type of data can be descriptive or categorical and is often collected through interviews, surveys, or observations. Examples of qualitative data include the color of a flower, the texture of a fabric, or the opinions expressed by individuals in a focus group.
Explanation:
what is the role of a scientist
Which best explains how photosynthesis is helpful to humans?
Group of answer choices
It produces proteins, which humans can eat.
It provides oxygen for humans to breathe.
It increases the levels of carbon dioxide in the air.
It reduces the amount of harmful rays released by the sun.
Anyone know how to solve this? It's biotechnology haha.
Based on the gel results, patient A has lower levels of the protein corresponding to standard IV in their blood.
The protein that is different in patient B is the one corresponding to the band that did not match with any of the standards. The fact that the band on the gel for patient B was smaller in size compared to the control band suggests that the protein is of smaller molecular weight than the standard.
What is the significance of the results of the protein levels for patients A and B?Since these are essential blood proteins, the difference in protein levels for both patients may have implications for their health.
For patient A, lower levels of the protein corresponding to standard IV may indicate a potential health issue related to the function of that protein.
For patient B, the difference in the size of the protein may indicate a mutation or alteration in the gene responsible for encoding that protein, which could lead to a functional difference or potential health issue. Further testing and analysis would be needed to determine the specific implications for each patient.
Learn more about protein levels at: https://brainly.com/question/29520808
#SPJ1
Describe the events in excitation contraction coupling
Answer:
cardiac contraction-excitation The sequence of occurrences, from the generation of an electrical impulse to the contraction of cardiac muscles, is referred to as coupling. This procedure is essential because it enables the heart to beat in a regulated manner without requiring conscious effort. With the help of EC coupling, the cardiac muscles sequentially contract, allowing blood to be pumped between 60 and 100 times per minute, first to the lungs and subsequently the rest of the body.
Explanation:
what happens to the frequency of non beneficial traits in the population over time in simple terms?
The frequency of non-beneficial traits in a population tends to decrease overtime due to natural selection. These traits do not provide any advantage to an organism in its environment, and may even be detrimental to its survival or reproduction.
Organisms with non-beneficial traits may be less likely to survive and reproduce, so their genes are less likely to be passed on to the next generation.
If having 8 repeats at loci 1 is found in 10 % of the US population, having 12 repeats at loci 2 is found in 5% of the US population, having 7 repeats at loci 3 is found in 10% of the US population, and having 5 repeats at loci 4 is found in 30% of the US population, if the US has a population of 300 million people, how many people in the US would have this DNA profile at those 4 loci?
This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci.
What is DNA?DNA (Deoxyribonucleic acid) is a long, complex molecule that contains the genetic instructions used in the development and function of all known living organisms and many viruses. It is often described as the "blueprint" or "code" of life. DNA is composed of four types of nucleotides, which are the building blocks of the DNA molecule. Each nucleotide contains a sugar molecule, a phosphate group, and a nitrogenous base (adenine, thymine, guanine, or cytosine). The sequence of these bases along the DNA molecule determines the genetic information it carries.
Here,
To determine the number of individuals in the US population that have a specific DNA profile at these four loci, we need to multiply the percentage of individuals with each genotype at each loci. Let's start by finding the number of individuals in the US population who have 8 repeats at loci 1. We know that 10% of the US population has this genotype, so:
Number of individuals with 8 repeats at loci 1 = 10% of 300 million
= 0.1 x 300,000,000
= 30,000,000
Similarly, we can find the number of individuals with 12 repeats at loci 2:
Number of individuals with 12 repeats at loci 2 = 5% of 300 million
= 0.05 x 300,000,000
= 15,000,000
For loci 3:
Number of individuals with 7 repeats at loci 3 = 10% of 300 million
= 0.1 x 300,000,000
= 30,000,000
And finally, for loci 4:
Number of individuals with 5 repeats at loci 4 = 30% of 300 million
= 0.3 x 300,000,000
= 90,000,000
To find the number of individuals with all four of these genotypes, we need to multiply these four values:
Number of individuals with all four genotypes = 30,000,000 x 15,000,000 x 30,000,000 x 90,000,000
= 3.87 x 10²⁵
This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci. In practice, forensic DNA profiling typically looks at many more loci to increase the uniqueness of the DNA profile.
To know more about DNA,
https://brainly.com/question/30396067
#SPJ9
can someone please help me, i dont know how to answer this. please give me pointers
Because, the passage itself describes about the nature of greenhouse effects. The greenhouse gases are absorbed by the soil. In order to protect the sensitive plants, we are going now for the modern greenhouse method i.e. artificial method. Transparent material which is nothing but like a sheet which covers the house is contructed to oppose the greenhouse gases to protect the plants. As the heat passes, some amount of heat won't escapes to atmosphere. This results in excess heat inside and leads the plants to die. Scientists say it's better to be the natural method of greenhouse effects.
For the animal pictured in the boxes below, type at least 3 adaptions they have and explain how these adaptions help them survive in their environments
Answer:
Edmentum sucks
Explanation:
The organisms in a desert biome must have wide feet as as to wade through sand, this is not necessary in a tundra biome.
The term biome refer to a zone of life found on earth. The descriptions of tundra and desert biomes are shown as follows;
A tundra biome is a cold region in which trees are absent and living organisms have to survive under very cold conditions.
A desert biome is covered mostly with sand and has alternating hot and cold conditions in the day and in the night.
The organisms in a desert biome must have wide feet as as to wade through sand. This is not necessary in a tundra biome composed mostly of snow. Also, in a desert biome, organisms have hairy eyes to keep away sand. This is not required in a tundra biome.
Learn more about tundra biome: brainly.com/question/1204226
Which part of the body contains bile an enzyme that helps down lipids
Answer:
liver
Explanation:
The liver produces bile, a solution that helps you digest fats. The gallbladder stores bile. As fatty food enters the upper portion of your small intestine (the duodenum), the gallbladder squeezes bile into the small intestine through the bile ducts.
ACADEMIC STUDY ON NATURAL SELECTION, THIS IS NOT A TEST!!!
Quadrat Quality
1. Draw Conclusions A classmate says that this is his one and only quadrat sample for a study of the grasshopper population in a 20-acre meadow. List the flaws in his sampling methods.
The flaws in your classmate's sampling method include:
Small Sample SizeUnrepresentative Sampling LocationLimited Sampling FrequencyLack of StandardizationLack of ReplicationBias toward visible grasshoppersWhat is quadrat sampling?Quadrat sampling is a technique for immediately counting the number of organisms in a portion (or sample) of the habitat. It is used to calculate population density, frequency, and dispersion estimates.
Quadrat positions may be selected at random or along a transect.
Learn more about quadrat sampling at: https://brainly.com/question/18065135
#SPJ1
Which of the following is true about photosynthesis?
A.
Chloroplasts release energy from the chemical bonds in sugar.
B. Chloroplasts convert light energy into chemical energy in the form of sugar.
C. Mitochondria convert light energy into chemical energy in the form of sugar.
D. Mitochondria release energy from the chemical bonds in sugar.
Answer:
B
Explanation:
Mitochondria both deal with cellular respiration, not photosynthesis, meaning that C and D are wrong. and if you look at the photosynthesis equation, it equals glucose = sugar
If I push on the ground with my foot with a force of 140 N Backwards, what will the force pushing my skateboard be?
The force pushing your skateboard will be equal in size and the opposite of the force your foot applies to the ground, assuming there is no friction between the skateboard and the ground.
Skateboard: What is Newton's third law?Newton's first law states that unless another force acts on an item in motion, it will continue to move in the same direction and at the same pace. As long as no force is applied to a rolling skateboard, it will continue to move in the same direction and at the same pace.
What will happen if you're standing on the floor to the force of your body pressing down on it?Every action has an opposite and equal response, according to Newton's third law. You may not realize it, but when you stand on the ground, you are exerting force against the ground since gravity is pulling you down due to your weight. The floor is pushing back in response.
to know more about skateboard here:
brainly.com/question/30286828
#SPJ1
Question 8 (2 points)
What describes the unusually large release of plasma from the sun's corona? (2 points)
O a
Ob
Oc
Od
Aurora
CME
Solar flare
Solar wind
Question 9 (2 points)
The unusually large release of plasma from the sun's corona is described as a CME (coronal mass ejection).
What is CME (coronal mass ejection)?
A coronal mass ejection (CME) is a massive burst of solar wind and magnetic fields that are ejected from the sun's corona into space. These eruptions can release billions of tons of charged particles and plasma at speeds of several million miles per hour. When a CME collides with the Earth's magnetic field, it can cause geomagnetic storms, auroras, and other disruptions to our planet's space environment. CMEs can also have significant impacts on satellite and communication systems, as well as on power grids on the ground.
What is plasma?
plasma refers to the highly ionized gas consisting of a mixture of positively charged ions, negatively charged electrons, and neutral particles that are released from the sun's corona during a coronal mass ejection (CME).
To know more about CME, visit:
https://brainly.com/question/16524443
#SPJ1
1. Index fossils are useful tools for geologists.
A. What information can index fossils tell geologists? (4 points)
B. What are three characteristics of a good index fossil? (6 points)
Answer:
A. Index fossils are useful tools for geologists because they can provide information about the relative age of rocks and help to correlate rock formations across different locations. By identifying and dating the age of index fossils found in a particular rock layer, geologists can determine the approximate age of the rock layer and its correlation with other rock layers in the region.
B. Three characteristics of a good index fossil are:
Widespread distribution: A good index fossil should have a wide geographic distribution, which means that it should be found in multiple locations around the world. This helps to establish a correlation between different rock layers that contain the same index fossil.
Limited time range: A good index fossil should have a limited time range, meaning that it should have existed for a relatively short period. This allows geologists to narrow down the age range of the rock layer containing the fossil.
Easily recognizable: A good index fossil should be easily recognizable, even in small or fragmented pieces. This allows geologists to quickly identify and date the fossil, even if only a small portion of it is present in the rock layer.
Overall, a good index fossil should be distinctive, easily recognizable, have a wide distribution, and a limited time range, all of which can provide useful information for geologists studying the history of the Earth.
Explanation: