Biology High School

Fill in the blanks for the three statements of Cell Theory.
All______are made up of cells.
Cells come from other cells.
Cells are the basic unit of_______.
a. Life; cells
b. Abiotic factors; biotic factors
C. Living things; life
d. Plants; organelles

Answers

Answer 1

Answer:

c and a

Explanation:

Answer 2

Answer:

C. Living things; life

Explanation:

Image is attached

----------------------------------------------------------------------------------------------------------------

Have a good day :)

Fill In The Blanks For The Three Statements Of Cell Theory.All______are Made Up Of Cells.Cells Come From

Related Questions

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

There has a been decrease in the diversity of plants in the grasslands of the Edward's plateau. What has caused this to occur?

Answers

What the person above me said is correct!!! Good luck! Have a good day!


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

why do humans have good memory

Answers

Humans have good memory because of their brain, one part of the human brain has a function just for memory!

Which of the following are not properties of lipids?

Answers

Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.

All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.

Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.

Explanation:

There’s no options, add a photo pls

Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?

NO LINKS! NO PDF'S. Please, help ASAP!

Answers

1. the birds call is a behavioral adaptation 2. the animals body temp changing is physical. 3. the birds flying is a behavioral adaptation.

pls answer pls please​

Answers

Answer:

1.it's beak is pointed and  slightly curved at pointed

2.it's upper part is brown and lower part is white

3.it's legs is black

Explanation:

HELPPp!!!!!!I’ll mark u brainly

Answers

Answer:

Genotypes - Phenotypes:

TT - Thin

Tt - Thin

tt - Wide upside down

LL - Lopsided

Ll - Lopsided

ll - Parallel

VV - Vertical

Vv - Veritcal

vv - Horizontal

PP - Pink

Pp - Pink

pp - Red

The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.

Answers

-unrestricted prey species growth


Explanation: the less predators the more the prey will reproduce, hence the fact that no one is there to consume them they will increase at a very accelerated speed

PLEASE ANWSER CORRECT AND ASAPPL

Answers

Answer: B. Mostly nitrogen, carbon dioxide, water vapor.

___________________ is a molecule that organisms get from the air or water around them and use to release energy.

Answers

Answer:

Oxygen

Explanation:

In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

When the ocean absorbs CO2 it leads to what?

Answers

Explanation:

Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.

Answer:

If the ocean absorbs a lot of CO2 it is most likely to become acidic

The female reproductive and endocrine systems work interactively for which main purpose?

A. To control hormone levels to prepare the body for pregnancy

B. To maintain homeostasis by removing waste products from the body

C. To release neurotransmitters during times of stress

D. To exchange gases to support cellular aerobic respiration

Answers

The answer is definitely A.

Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk

Answers

Answer:

Honey

Explanation:

Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.

Fill in the Blank
Complete the following sentence.
Before a plant grown in a greenhouse can be planted in a field or garden, it should first be ______ of.

FiLl In ThE bLaNk

Answers

Answer:

hardening

Explanation:

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

True or false Biodiversity has both economical and ecological value within an ecosystem.

Answers

Explanation:

biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

Please please help me!!!

Answers

Answer:

1. Hormones

2. Reproductive system

Explanation:

the endocrine system is responsible for producing hormones, and the hormones produced by the pituitary gland regulate reproductive systems.

Other Questions
Which of the following expressions can be setequal to 2.74x - 7.9 to form an equation thathas no solution?A 2.74x - 7.9B 7.9x - 7.9C 2.74x + 7.9D 7.9x + 2.74 Read the following introductory paragraph, which is missing a hook Les Paul was a legendary guitarist, songwriter, and inventor. If you don't know his work, a minute of googling will bring up loving remembrances from nearly everyone in the music industry . It isn't a stretch to say that without Les innovations in guitar and recording technology, the music we love wouldn't sound the same, either in person or on a record. What sticks with me though, is his incredible passion for performing. He was one of those artists who simply had to play order to live a young man, his right arm was crushed in a car accident. He had the doctors and pin it at a permanent 90 degree angle, so he could still hold a guitar. As an older man, arthritis stiffened his fingers beyond bendingHe taught himself how to play with them straight When sea ice melts, there will be a significant amount of sea level rise.O TrueO False Simplify (2.2 x 10')= (1 104) and write theanswer in scientific notation.a. 2.2 x 10b. 22c. 2.2 x 1011d. 2.2 x 10? Which genocide that you learned about was the worst in your opinion and why? (Provide specific detailsand factual information in your response)PLEASE IM BEGGING I NEED HELP LIKE ASAP Which sentence uses the same meaning of the underlined word in the sentence below?The posture of the company is to produce high quality products with minimal impact on the environment.A. The ballet dancer's graceful posture was due to years of training his body.B. The country's posture was very defeated after losing many soldiers in the Vietnam War.C. The athlete forced himself to have a sad posture when he left his hometown's team.D. The movie star's posture to the media is that she is generous and wholesome. What can be used to customize how the data is tracked in the Conversionscolumn What are the missing coefficients for C3H8 + o2 = Co2 +H2O which one is it?I'll mark brainliest if correct Larry and 3 friends went to a basketball game. Theypaid $5.00 for each of their tickets and each bought abag of candy. If they spent a total of $28, how muchwas each bag of candy? A person is observing the oscillations of a wave. If the wave source begins to move away from the person, what will the person notice?A.The wavelength will decrease.B.The wave appears to have a different amplitude.C.The wave appears to change speed.D.The wave appears to oscillate at a different rate. laura has a 3-digit combination lock on her briefcase and has forgtten the combination. If she knows that the first digit is a 3, and the second digit is a prime, how many numbers must Laura try before the lock is sure to open? Which of the following can override the power of the U.S. Government? A states B. citizens C. neither the states nor citizens Please help!!!!!!!1. Which data shows that Neanderthals are not the ancestors of modern humans?A.Differences in Neanderthals and human DNA.B.Evidence from Neanderthals burial grounds C.Muscular build of Neanderthals as compared to humans D.Patterns of Neanderthal extinction.2. Which mammal is most closely related to bats (chiropterans)A. CarnivoransB. XernarthansC. Primates D. Rodentains3. Which radioactive isotope would be used to determine the specific age of a Paleozoic rock formation?A. Beryllium-10(1.5 million years)B. Carbon-14(5715 years)C. Thorium-232(14 billion years)D. Uranium-235(704 million years)4. According to the Hardy- Weinberg principle, which situation would disrupt genetic equilibrium?A. A large pop of deer inhabits a forest region.B. A particular pop of flies mates randomly.C. A pop of flowering plants always has the same group of natural predators.D. A small pop of birds colonizes a new island.5. According to the endosymbiont theory, which part of the eukaryotic cell evolved from a prokaryotic cell?A. Chloroplast B. Golgi apparatusC. NucleaseD. Ribosome ANSWER FAST NO LINKS23=x-139+x=1412=x+8 what is the median for this set of numbers 10,9,23,68,70,4,12,4 HELPPPPPPPPPPPP THIS IS A MEGA TEST Felicia pours 3/4 of a 2 1/2-liter bottle of chlorine solution into a swimming pool. Then, she measures out the liter of the remaining solution to use to clean the pool filter. How much chlorine solution is left in the bottle? Find the missing number in each sequenceWill give Brainliest Find the area of the following triangle: 17 9 14 10 Note: Figure not to scale. An empty water tank has a rectangular base with side lengths of 1.2 m and 2.3 m. The weight of the tank applies a pressure of 350 Pa to the surface it is resting on. What is the weight of the tank?