Given that f(x) = ax – 5 and f(4) = 15, determine the value of a.

Answers

Answer 1

Given that f(x) = ax – 5 and f(4) = 15, then the value of a is 5

The given function is:

f(x)  =  ax  -  5

If f(4)  =  15, then x = 4

Substitute x = 4 into f(x) = ax - 5

f(4)  =  a(4)  -  5

15   =  4a   -  5

Solve for a by adding 5 to both sides

15  +  5  =  4a  -  5  +  5

20    =  4a

Divide both sides by 4

4a/4   =  20/4

a    =  5

Given that f(x) = ax – 5 and f(4) = 15, then the value of a is 5

Learn more on linear functions here: https://brainly.com/question/15602982


Related Questions


[tex]2 \frac{2}{3} + 3 \frac{1}{3} + 1 \frac{2}{3} [/tex]
aaaaaaaaaadddddddd​

Answers

Solution, [tex]=2 \frac{2}{3} + 3 \frac{1}{3} + 1 \frac{2}{3} \\ = 2 + 3 + 1 + \frac{2}{3} + \frac{1}{3} + \frac{2}{3} \\ = 6 + \frac{2 + 1 + 2}{3} \\ = 6 + \frac{5}{3} \\ = 6 + 1 + \frac{2}{3} \\ 7 \frac{2}{3} [/tex]Alternatively,[tex] = 2 \frac{2}{3} + 3 \frac{1}{3} + 1 \frac{2}{3} \\ = \frac{8}{3} + \frac{10}{3} + \frac{5}{3} \\ = \frac{23}{3} \\ =7 \frac{2}{3} [/tex]

~nightmare5474~

[tex]2\frac{2}{3} + 3\frac{1}{3} + 1\frac{2}{3} = 7\frac{2}{3} [/tex]

let's convert each mixed fraction into improper fractions. Therefore,

What are Improper fractions:

Improper fractions are fractions that has the numerator bigger than the denominator.

[tex]2\frac{2}{3} = \frac{8}{3} [/tex]

[tex]3\frac{1}{3} = \frac{10}{3} [/tex]

[tex]1\frac{2}{3} = \frac{5}{3} [/tex]

Therefore,

[tex]\frac{8}{3} + \frac{10}{3} + \frac{5}{3} [/tex]

[tex] \frac{8}{3} + \frac{10}{3} + \frac{5}{3} = \frac{8 + 10 + 5}{3} = \frac{23}{3} [/tex]

Let's convert our answer back to mixed fractions

[tex]\frac{23}{3} = 7\frac{2}{3} [/tex]

learn more on fraction here:https://brainly.com/question/25412?referrer=searchResults

A basket of fruit contains 6 apples, 5 oranges, 3 bananas, and 2 limes.Which of the following statements about the fruits in the basket are true?Select the two correct statements.

Answers

Answer:

[tex]6 + 5 = 11 + 3 = 14 + 2 = 16[/tex]

[tex]6 \div 5 \div 3 \div 2 = 0.2[/tex]

[tex] 6 \times 5 \times 3 \times 2 = 180[/tex]

Step-by-step explanation:

If its addition add them, multiplication multiply them, division divided them.

Answer:

Step-by-step explanation:

i need help sorry no answer got u

Help me please i really need it​

Answers

Answer:

Step-by-step explanation:

RSB is a right angle

12. RSB is 90 degrees

13. A right angle is 90 degrees

H is between P and S

14. PS + PH = HS

15. Deductive Reasoning

Determine if the sequence below is arithmetic or geometric and determine the common difference/ ratio in simplest form

15, 11 ,7, …

Answers

Answer:

This is the arithmetic sequence which has a common difference that equals to -4.

Step-by-step explanation:

An arithmetic sequence is a sequence with common difference. A common difference can be found by subtracting previous term with next term.

A common difference can be expressed in [tex]\displaystyle \large{d=a_{n+1}-a_n}[/tex] where d stands for common difference.

________

Moving to the question given. We have a sequence with given 15,11,7, ... first subtract 15 with 11.

11-15 = -4

7-11 = -4

Therefore, we can conclude that the common difference is -4 thus making the given sequence an arithmetic.

Let me know if you have any question so regarding the sequence!

To get to the next term in this sequence, multiply the last term by 2.5. What is the value of the next term?

1, 2.5, 6.25, 15.625, ...

HELP ASAP WILL GIVE BRAINLIEST

Answers

Answer:

39.0625

Step-by-step explanation:

15.625 times 2.5= 39.0625

You're just multiplying each value by 2.5

1 times 2.5= 2.5

2.5 times 2.5= 6.25

6.25 times 2.5= 15.625

and then 15.625 times 2.5= 39.0625

Which one is correct

Answers

D IS CORRECT BC 30/-2 =-15 AND WHEN U DIVIDE 30 BY A NEGATIVE NUMBER THE SIGN FLIPS THE OTHER WAY

can you help me solve 4x - 15 = 17 - 4x

Answers

[tex]4x-15 = 17-4x\\\\\implies 4x +4x = 17 +15\\\\\implies 8x = 32\\\\\implies x = \dfrac{32} 8\\\\\implies x = 4[/tex]

line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form

Answers

Answer:

y=5/4x -7

Step-by-step explanation:

Hope this helps!

Is this table proportional?
XY
1 3 3
4 12
5 15
7 21

Answers

Yes it is proportional for a table

Jose left the airport and traveled toward the mountains. Kayla left 2.1 hours later traveling 35 mph faster in an effort to catch up to him. After 1.2 hours Kayla finally caught up. Find Jose's speed.

Answers

Answer:   20 mph

========================================================

Explanation:

x = Jose's speed in mph

x+35 = Kayla's speed since she drives 35 mph faster than Jose

Jose gets a 2.1 hour head start and it takes Kayla 1.2 hours to reach him. So this means Jose has been driving for 2.1+1.2 = 3.3 hours when Kayla reaches him. The distance he travels is

distance = rate*time

d = r*t

d = x*3.3

d = 3.3x

while Kayla's distance equation is

d = r*t

d = (x+35)*1.2

d = 1.2x+42

Since Kayla meets up with Jose at the 1.2 hour mark, this means the two distances they travel is the same. Set their distance expressions equal to one another. Solve for x.

3.3x = 1.2x+42

3.3x-1.2x = 42

2.1x = 42

x = 42/(2.1)

x = 20

Jose's speed is 20 mph, while Kayla's speed is x+35 = 20+35 = 55 mph.

Jose's fairly slow speed is probably due to a number of factors such as heavy traffic, icy roads, or poor visibility. Kayla probably got a bit of a break with more favorable conditions.

Since Jose travels at 20 mph and does so for 3.3 hours, he travels d = r*t = 20*3.3 = 66 miles. Kayla travels d = r*t = 55*1.2 = 66 miles as well. We get the same number each time to help confirm the answer.

please help
step bu step

Answers

Answer:

what ang hirap nmn anong grade ka na ba

Does anyone know the answer for this question? I really need it.

Answers

Your answer is 9 1/3

3 x 9 1/3
= 3/1 x 28/3
= 84/3
= 28

When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?

Answers

Answer:

8.705-4.93=3.775

Hope This Helps!!!

1) f(4) = g(4)
2) f(4) = g(-2)
3) f(2) = g(-2)
4) f(-2) = g(-2)

Answers

Answer: 4)

Step-by-step explanation:

f(4) = -14

g(4) = 10

g(-2) = 4

f(2) = -8

f(-2) = 4

The correct statement is 4) f(-2) = g(-2)

Or by inspection, we can see that the graph f(x) intersects g(x) at x = -2 and    y = 4. So, f(-2) = g(-2) = 4 is true

What is an equivalent ratio

Answers

Answer:

Equivalent ratios (which are, in effect, equivalent fractions) are two ratios that express the same relationship between numbers. We can create equivalent ratios by multiplying or dividing both the numerator and denominator of a given ratio by the same number. Two ratios that have the same value are called equivalent ratios. To find an equivalent ratio, multiply or divide both quantities by the same number. It is the same process as finding equivalent fractions.

when 2 ratios are the same or equivalent by simplifying. For example 1 to 4 is the same as 2 to 8 because when I simplify it i get 1 to 4

Understand how to work with negative bases and negative exponents.
5^2 =
5^-2 =
(-5)^2 =
- 5^2 =
(Remember to find the base, then multiply.)

Answers

Answer:

[tex]Understand \: how \: to \: work \: with \: negative \: bases \\ \: and \: negative \: exponents. \\

\bold{answer - } \\ {5}^{2} = 5 \times 5 = 25 \\ {5}^{ - 2} = \frac{1}{ {5}^{2} } = \frac{1}{25} = 0.04 \\ {( - 5)}^{2} = ( - 5) \times ( - 5) = 25 \\ - {5}^{2} = ( - 5) \times ( - 5) = 25 \\ \\ \bold \purple{hope \: it \: helps \: ♡}[/tex]

A desk drawer is shaped like a rectangular prism. The height of the drawer is 7 inches. The bottom of the drawer has an area of 210 square inches.

What is the volume of the desk drawer?

Enter your answer in the box.

Answers

Answer:

1470 inches cubed

Step-by-step explanation:

Vol=length × width × height

But ALSO,

length × width = Area,

So we find another Volume equation,

Vol = BaseArea × height

This is the information you are given in the question.

Vol = 210 × 7

Vol = 1470 inches cubed

Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?

Answers

Answer:

f(8) = $48

EQUATION

f(x)= 8+5(x)

Step-by-step explanation:

initial value = $8

every week there is an additional $5 added.

f(x) = 8+5x

f(8) = 8+ 5(8) = 8 + 40 = 48.

At the end of week 8 (x=8) , Jamal has $48 (y=48) saved.

The table shows the final score of four golfers.
Golfer Final Score
Joe
-2
Allen
-5
Tara
-8
Violet
-4
Whose score was the lowest? Whose was the highest? Select your answers from the drop-down lists.
score was the lowest.
score was the highest.
Students, draw anywhere on this slide!
PER Deck eractive Skoe

Answers

highest is joe because it the most closest to 0
Lowest is Tara because it the most far from 0

Answer:

Joe score was the highest. Tara score was the lowest.

Step-by-step explanation:

Evaluate.

(jk−1)÷j when j=−4 and k=−0.7

Enter your answer as a decimal in the box.

Answers

Answer:

(jk - 1) / j

jk = (-4 x -0.7) = 2.8

(2.8 - 1) / - 4

1.8 / -4 = -0.45

Answer is -0.45 when j = -4 and k = -0.7

Activity 1.
Direction. Using the diagram below, form ratios. Express them in lowest term to
To form a proportion

Answers

Answer:

6:3 =2:12:2=1:16:13:24:14=2:7

Solve for x: one over eight 1/8(8x + 15) = 24

Answers

Answer:

22[tex]\frac{1}{8}[/tex]

Step-by-step explanation:

I hope this helps!!!

Classify the Triangle by its sides and angles. 140° Right Scalene Right Isosceles Equilateral Obtuse Isosceles Acute Isosceles Obtuse scate Acute Scalene​

Answers

Answer: Obtuse Isosceles.

Explanation: Two angles are congruent, which means the triangle is isosceles. One angle is over 90°, which means the triangle is obtuse.

To bring a "carry-on" bag onto an airplane the bag needs to weigh less than 25 pounds. Right now Julie's carry-on bag weighs 32 pounds. How much weight must Julie remove from her bag?

Answers

My answer needs to be 32-25=7

How do I multiply a fraction and a whole number? Please explain step by step to get marked

Answers

Any whole number can be written as a fraction. All we do is place the number over 1.

For example, the whole number 7 is the same as the fraction 7/1.

If we wanted to multiply the whole number 7 with the fraction 2/3 then...

[tex]7 * \frac{2}{3}\\\\\frac{7}{1} * \frac{2}{3}\\\\\frac{7*2}{1*3}\\\\\frac{14}{3}\\\\[/tex]

In the jump from the second step to the third step, we multiply straight across. The numerators multiply together. The denominators multiply together. The fraction 14/3 cannot be reduced because 14 and 3 don't have any factors in common other than 1.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

Geoff works at a warehouse , earning $17.50 per hour plus a $200 what’s the equation?

Answers

Answer:

P = 17.50x + 200

Step-by-step explanation:

x is the number of hours worked

P is how much money Geoff earns

Let simplify :- 2 ⅓ ÷ 1 ⅛ ÷ 2 ¼​

Answers

Step-by-step explanation:

7/2 ÷ 9/8 ÷ 9/4

7/2 × 8/9 × 4/9

= 112/81

= 1 ³¹/81

[tex]\large\huge\green{\sf{Question:-}}[/tex]

2 ⅓ ÷ 1 ⅛ ÷ 2 ¼

[tex]\large\huge\green{\sf{Answer:-}}[/tex]

=2 ⅓ ÷ 1 ⅛ ÷ 2 ¼ =???

=7/2 ÷ 9/8 ÷ 9/4

=7/2 × 8/9 × 4/9

= 224/162

=112 /81

=1 ³¹/81

The impact on sampling of increasing the sample size is: There is no specific relationship between sample size and sampling error.

Answers

Using margin of error, it is found that increasing the sample size results in a smaller sampling error.

The equation for the margin of error is given by:

[tex]M = c\frac{s}{\sqrt{n}}[/tex]

In which:

c is the critical value according to the distribution used.s is the standard deviation, either of the sample or of the population.n is the sample size.

From the equation, it can be noted that the margin of error is inversely proportional to the square root of the sample size, hence, increasing the sample size results in a smaller sampling error.

To learn more about margin of error, you can take a look at https://brainly.com/question/25821952

Four times a number is equal to the number increased by 24 find the number

Answers

Answer:

8

Step-by-step explanation:

Let the number is x.

Translate the given into equation and solve for x:

4x = x + 244x - x = 243x = 24x = 8
Other Questions
A 330kg motorcycle is moving at 28m/s . What is the momentum of the motercycle. Which sizes can he display? Choose all that apply.linch40.5 inch3 inch81 inch1.5 inch Your little brother wants hot chocolate ot be 150 degrees, but you accidentally heated the water to 175 degrees. If after 5 minutes the temperature is 165 and the temperature in your house is 70 degrees, how long will your little brother have to wait to drink his hot chocolate? Please quickly answer number 17&18 I will give brainliest What is the measurement of pie? How did the Third Crusade lead to the Fourth Crusade? Please help. I really need an explanation on how to solve and graph the first equation. 1. The length of each side of a square increased by 40%. By what percent does the area of the square increase?2. The length of a rectangle increases by 20%, and the width decreases by 20%. What is the overall percent change in the area of the rectangle?(they are two separate questions) out of 100 couples each year that use natural family planning methods, such as fertility awareness, up to ____________ women may become pregnant. Identifying Errors on a Number Line Find the product using the number line. 3(-6) = A number line going from negative 7 to positive 3. An arrow goes from negative 6 to negative 4, from negative 4 to negative 2, and from negative 2 to 0. What error(s) are shown here? Select three options. The arrows should be a length of 2. The arrows should be a length of 6. The arrows should be pointing in the positive direction. The arrows should start at zero. The arrows should point in the negative direction. point:(-5,1); slope: -4write in point-slope form: can totalitarian rule ever be a good thing? If 2 inches are equivalent to 5 centimeters, how many square centimeters are in one square inch Why does a rectangle with different side lengths have only 2 lines of symmetry?A. all four angles are congruent, and all four sides are congruentB. all four angles are congruent, and opposite sides are congruent for a horizontal and diagonal line of reflectionC. all four angles are congruent, and opposite sides are congruent for a horizontal and vertical line of reflectionD. all four angles are congruent, and opposite sides are congruent for two diagonal lines of reflection that cut through different angles If a plane travels 900kms in 3 hours what is its rate of speed expressed as a unit rate Please help this is the final. Identify a minimum of two ways companies compete for your money. In a minimum of five sentences each, explain in what way each of those tactics has been proven to be successful. Can someone help me answer please Read paragraph 24 of "Thank You, M'am": "Then, Roger, you go to that sink and washyour face," said the woman, whereupon she turned him loose, at last. Roger looked atthe door, looked at the woman, looked at the door, and went to the sink. -What doesthis paragraph tell the reader about Roger's feelings?1. It illustrates that Roger is enjoying being in Mrs. Jones's company2. It demonstrates Roger's confusion about his situation3.It highlights how much Roger dislikes Mrs. Jones4.It shows how angry Roger is that he wasn't able to steal Mrs. Jones's purseplease help im confused !!! Part 2: Find the area of each of the given shapes below. If a shape has shading, find the area of the shaded region only. NO LINKS! Determine if the two lines are parallel. Explain your answer for brainliest.3x+4y=8-12x-9y=27