HELP QUICK!
Read the description of f below, and then use the drop-down menus to complete an explanation of why f is or is not a function.

f relates each student in South High School to their grade point average (GPA) and number of credits earned.

Answers

Answer 1

Using the function concept, it is found that f is a function, as each student is related to only one GPA and only one number of credits.

In a function, one value of the input can be related to only one value of the output.

In this problem:

The input is the student.The output is the student GPA, and the number of credits earned.

Each student is related to only one GPA and only one number of credits, hence one value of the input is related to only one value of the output, and f is a function.

To learn more about the function concept, you can take a look at https://brainly.com/question/12463448


Related Questions

State whether the system is consistent or inconsistent. If it is consistent, then state whether the graphs' equations are dependent or independent. State the number of solutions.

Answers

If a system has at least one solution, it is said to be consistent . If a consistent system has exactly one solution, it is independent . If a consistent system has an infinite number of solutions, it is dependent . When you graph the equations, both equations represent the same line.

1) f(4) = g(4)
2) f(4) = g(-2)
3) f(2) = g(-2)
4) f(-2) = g(-2)

Answers

Answer: 4)

Step-by-step explanation:

f(4) = -14

g(4) = 10

g(-2) = 4

f(2) = -8

f(-2) = 4

The correct statement is 4) f(-2) = g(-2)

Or by inspection, we can see that the graph f(x) intersects g(x) at x = -2 and    y = 4. So, f(-2) = g(-2) = 4 is true

line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form

Answers

Answer:

y=5/4x -7

Step-by-step explanation:

Hope this helps!

What is an equivalent ratio

Answers

Answer:

Equivalent ratios (which are, in effect, equivalent fractions) are two ratios that express the same relationship between numbers. We can create equivalent ratios by multiplying or dividing both the numerator and denominator of a given ratio by the same number. Two ratios that have the same value are called equivalent ratios. To find an equivalent ratio, multiply or divide both quantities by the same number. It is the same process as finding equivalent fractions.

when 2 ratios are the same or equivalent by simplifying. For example 1 to 4 is the same as 2 to 8 because when I simplify it i get 1 to 4

Solve for x: one over eight 1/8(8x + 15) = 24

Answers

Answer:

22[tex]\frac{1}{8}[/tex]

Step-by-step explanation:

I hope this helps!!!

SCO
Sarah put 15 gumdrops on the roof of her
gingerbread house. How many gumdrops
will she need to make 16 more houses
exactly like this one?
MY
gumdrops

Answers

Answer: 240 gumdrops

Step-by-step explanation:

1 house: 15 gumdrops

16 houses : 240 gumdrops

1 x 16 = 16

15 x 16 = 240

Determine if the sequence below is arithmetic or geometric and determine the common difference/ ratio in simplest form

15, 11 ,7, …

Answers

Answer:

This is the arithmetic sequence which has a common difference that equals to -4.

Step-by-step explanation:

An arithmetic sequence is a sequence with common difference. A common difference can be found by subtracting previous term with next term.

A common difference can be expressed in [tex]\displaystyle \large{d=a_{n+1}-a_n}[/tex] where d stands for common difference.

________

Moving to the question given. We have a sequence with given 15,11,7, ... first subtract 15 with 11.

11-15 = -4

7-11 = -4

Therefore, we can conclude that the common difference is -4 thus making the given sequence an arithmetic.

Let me know if you have any question so regarding the sequence!

Four times a number is equal to the number increased by 24 find the number

Answers

Answer:

8

Step-by-step explanation:

Let the number is x.

Translate the given into equation and solve for x:

4x = x + 244x - x = 243x = 24x = 8

emma has 63 pencils noah has 49 penecils and michel has 77 pencils.Use the GCF and the distributive property to find the total number of pencils

Answers

Step-by-step explanation:

the greatest common factor (GCF) is 7.

it is 9×7, 7×7 and 11×7.

so the total number of pencils is

7×(9 + 7 + 11) = 7×27 = 189

Help me please i really need it​

Answers

Answer:

Step-by-step explanation:

RSB is a right angle

12. RSB is 90 degrees

13. A right angle is 90 degrees

H is between P and S

14. PS + PH = HS

15. Deductive Reasoning

Does anyone know the answer for this question? I really need it.

Answers

Your answer is 9 1/3

3 x 9 1/3
= 3/1 x 28/3
= 84/3
= 28

To get to the next term in this sequence, multiply the last term by 2.5. What is the value of the next term?

1, 2.5, 6.25, 15.625, ...

HELP ASAP WILL GIVE BRAINLIEST

Answers

Answer:

39.0625

Step-by-step explanation:

15.625 times 2.5= 39.0625

You're just multiplying each value by 2.5

1 times 2.5= 2.5

2.5 times 2.5= 6.25

6.25 times 2.5= 15.625

and then 15.625 times 2.5= 39.0625

Classify the Triangle by its sides and angles. 140° Right Scalene Right Isosceles Equilateral Obtuse Isosceles Acute Isosceles Obtuse scate Acute Scalene​

Answers

Answer: Obtuse Isosceles.

Explanation: Two angles are congruent, which means the triangle is isosceles. One angle is over 90°, which means the triangle is obtuse.

help me plz ineed help

Answers

Answer:

23°

Step-by-step explanation:

Opposite angles so:

60° = 2x + 14

Therefore:

x = 23°

Answer:

x is 23°

Step-by-step explanation:

those opposite angles and are always equal to each other...so to get x take 60-14 then answer divide by two

what is the answer i need done by midnight -15x+60<105

Answers

Answer:

[tex]x > -3[/tex]

Step-by-step explanation:

Isolate the variable. Treat the < sign like an equal sign, in that what you do to one side, you do to the other.

Do the opposite of PEMDAS. PEMDAS is the order of operations, and stands for:

Parenthesis

Exponents (& Roots)

Multiplications

Divisions

Additions

Subtractions

~

First, subtract 60 from both sides of the equation:

-15x + 60 (-60) < 105 (-60)

-15x < 45

Next, divide -15 from both sides of the equation. Note that when you multiply or divide a negative number, you must flip the sign:

(-15x)/-15 < (45)/-15

x < 45/(-15)

x > -3

[tex]x > -3[/tex] is your answer.

~

Which one is correct

Answers

D IS CORRECT BC 30/-2 =-15 AND WHEN U DIVIDE 30 BY A NEGATIVE NUMBER THE SIGN FLIPS THE OTHER WAY

Activity 1.
Direction. Using the diagram below, form ratios. Express them in lowest term to
To form a proportion

Answers

Answer:

6:3 =2:12:2=1:16:13:24:14=2:7

The table shows the final score of four golfers.
Golfer Final Score
Joe
-2
Allen
-5
Tara
-8
Violet
-4
Whose score was the lowest? Whose was the highest? Select your answers from the drop-down lists.
score was the lowest.
score was the highest.
Students, draw anywhere on this slide!
PER Deck eractive Skoe

Answers

highest is joe because it the most closest to 0
Lowest is Tara because it the most far from 0

Answer:

Joe score was the highest. Tara score was the lowest.

Step-by-step explanation:

can you help me solve 4x - 15 = 17 - 4x

Answers

[tex]4x-15 = 17-4x\\\\\implies 4x +4x = 17 +15\\\\\implies 8x = 32\\\\\implies x = \dfrac{32} 8\\\\\implies x = 4[/tex]

The impact on sampling of increasing the sample size is: There is no specific relationship between sample size and sampling error.

Answers

Using margin of error, it is found that increasing the sample size results in a smaller sampling error.

The equation for the margin of error is given by:

[tex]M = c\frac{s}{\sqrt{n}}[/tex]

In which:

c is the critical value according to the distribution used.s is the standard deviation, either of the sample or of the population.n is the sample size.

From the equation, it can be noted that the margin of error is inversely proportional to the square root of the sample size, hence, increasing the sample size results in a smaller sampling error.

To learn more about margin of error, you can take a look at https://brainly.com/question/25821952

Evaluate.

(jk−1)÷j when j=−4 and k=−0.7

Enter your answer as a decimal in the box.

Answers

Answer:

(jk - 1) / j

jk = (-4 x -0.7) = 2.8

(2.8 - 1) / - 4

1.8 / -4 = -0.45

Answer is -0.45 when j = -4 and k = -0.7

When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?

Answers

Answer:

8.705-4.93=3.775

Hope This Helps!!!

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

A desk drawer is shaped like a rectangular prism. The height of the drawer is 7 inches. The bottom of the drawer has an area of 210 square inches.

What is the volume of the desk drawer?

Enter your answer in the box.

Answers

Answer:

1470 inches cubed

Step-by-step explanation:

Vol=length × width × height

But ALSO,

length × width = Area,

So we find another Volume equation,

Vol = BaseArea × height

This is the information you are given in the question.

Vol = 210 × 7

Vol = 1470 inches cubed

Understand how to work with negative bases and negative exponents.
5^2 =
5^-2 =
(-5)^2 =
- 5^2 =
(Remember to find the base, then multiply.)

Answers

Answer:

[tex]Understand \: how \: to \: work \: with \: negative \: bases \\ \: and \: negative \: exponents. \\

\bold{answer - } \\ {5}^{2} = 5 \times 5 = 25 \\ {5}^{ - 2} = \frac{1}{ {5}^{2} } = \frac{1}{25} = 0.04 \\ {( - 5)}^{2} = ( - 5) \times ( - 5) = 25 \\ - {5}^{2} = ( - 5) \times ( - 5) = 25 \\ \\ \bold \purple{hope \: it \: helps \: ♡}[/tex]

HELP ASAP PLEASE THIS IS FOR ALGEBRA

1. he slope of a line through the points (-2, 4) and (6, b) is -3/2 What is the value of b?
Explain your method for calculating b.

Answers

Answer:

Step-by-step explanation:

Use the slope formula to solve this problem. Slope, usually called m, is the change in y-values over the change in x-values.

m = (y2 - y1)/(x2 -x1)

It actually doesn't matter which point is the first point and which point is the second point. But you must be consistent.

So fill in -3/2 for the m

Let your (6, b) be your (x1, y1)

Let (-2, 4) be your (x2, y2)

So, the numbers fill into the formula like so:

-3/2 = (4 - b)/ (-2 - 6)

-3/2 = (4 - b)/(-8)

Multiply -8 on both sides of the equation.

(-8)(-3/2) = 4 - b

12 = 4 - b

Subtract 4 from both sides.

Don't lose the negative in front of the b

8 = -b

Multiply or divide by -1 on both sides.

-8 = b This is the answer.

**note: Its kinda crummy to use b in this equation, because b has a special meaning when you are working with linear equations. They should have given you a different variable. b usually stands for the y-intercept but in this problem it doesn't, it's just a variable representing an unknown value.

Is this table proportional?
XY
1 3 3
4 12
5 15
7 21

Answers

Yes it is proportional for a table

Jose left the airport and traveled toward the mountains. Kayla left 2.1 hours later traveling 35 mph faster in an effort to catch up to him. After 1.2 hours Kayla finally caught up. Find Jose's speed.

Answers

Answer:   20 mph

========================================================

Explanation:

x = Jose's speed in mph

x+35 = Kayla's speed since she drives 35 mph faster than Jose

Jose gets a 2.1 hour head start and it takes Kayla 1.2 hours to reach him. So this means Jose has been driving for 2.1+1.2 = 3.3 hours when Kayla reaches him. The distance he travels is

distance = rate*time

d = r*t

d = x*3.3

d = 3.3x

while Kayla's distance equation is

d = r*t

d = (x+35)*1.2

d = 1.2x+42

Since Kayla meets up with Jose at the 1.2 hour mark, this means the two distances they travel is the same. Set their distance expressions equal to one another. Solve for x.

3.3x = 1.2x+42

3.3x-1.2x = 42

2.1x = 42

x = 42/(2.1)

x = 20

Jose's speed is 20 mph, while Kayla's speed is x+35 = 20+35 = 55 mph.

Jose's fairly slow speed is probably due to a number of factors such as heavy traffic, icy roads, or poor visibility. Kayla probably got a bit of a break with more favorable conditions.

Since Jose travels at 20 mph and does so for 3.3 hours, he travels d = r*t = 20*3.3 = 66 miles. Kayla travels d = r*t = 55*1.2 = 66 miles as well. We get the same number each time to help confirm the answer.

Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?

Answers

Answer:

f(8) = $48

EQUATION

f(x)= 8+5(x)

Step-by-step explanation:

initial value = $8

every week there is an additional $5 added.

f(x) = 8+5x

f(8) = 8+ 5(8) = 8 + 40 = 48.

At the end of week 8 (x=8) , Jamal has $48 (y=48) saved.

To bring a "carry-on" bag onto an airplane the bag needs to weigh less than 25 pounds. Right now Julie's carry-on bag weighs 32 pounds. How much weight must Julie remove from her bag?

Answers

My answer needs to be 32-25=7

Other Questions
Shanika is an engineer at an amusement park who is experimenting with changes to the setup for a magnetic roller coaster ride. In one ride, there are two identical roller coaster cars (orange and green) that start on opposite sides of a large magnet located at the center of a station. Shanika wants to get the largest increase in potential energy she can by moving one car one space to the left or the right.Shanika can move the orange car to point A or point B, or she can move the green car to point C or point D. Which movement should she make? Why will that movement result in the largest increase in potential energy? Describe the magnetic force that will act on the roller coaster car she moves. To practice your business letter-writing skills, write a cover letter to accompany a rsum that youwould use to apply for the job of your choice. (Do not include the rsum as part of this exercise.)Remember to use the parts of a business letter and one of the letter styles discussed in this section. It was a lovely dinner-party of fourteen. The Duke and Duchess of Shoreditch, and their daughter the Lady Anne-Grace-Eleanor-Celeste-and-so-forth-and-so-forth-de-Bohun, the Earl and Countess of Newgate, Viscount Cheapside, Lord and Lady Blatherskite, some untitled people of both sexes, the minister and his wife and daughter, and his daughter's visiting friend, an English girl of twenty-two, named Portia Langham, whom I fell in love with in two minutes, and she with meI could see it without glasses. There was still another guest, an Americanbut I am a little ahead of my story.A. the long list of names required to address certain noblesB. the English custom of holding frequent balls and dinner partiesC. the lack of importance given to Americans by the EnglishD. the eccentric attitudes of the British upper class what were the revolutions in the atlantic world and who were some of the leaders? If xy + xb + ya + ab = 32 and x + a = 4 , then x + b = and i will give BRAINLIEST please give me the answer (click on file) Write an equation for the graph. 4-1) Consider any organization you are aware of from work, study, or the media. How do they manage people? Do people in those organizations feel important?4-2) What is your personal experience of performance appraisal and/or performance related pay? Consider the arguments made in this course, which best fit your experience? Ask two of others for their experience and briefly describe the appraisal system you want.you can give your own opinion in brief PLS HELP Jake has two dogs, Euclid and Pythagoras. Euclid is a smaller dog and Pythagoras is larger. Jake found that Pythagoras lost 13 pounds from January to June. If Pythagoras gains 1.2 times Euclids weight, Pythagorass weight would still be 1 4 pound less than he did in January. What is Euclids weight? (a) Write an equation that represents the scenario. Begin by defining your variable. (b) Solve the equation. Show your work. (c) What is Euclids weight? (d) Jake adopts a third dog, Riemann. Riemann weighs exactly twice what Euclid weighs. The combined weight of the three dogs is 1 60 2 pounds. What is Riemanns weight, and what is Pythagorass weight? Show your work. the word "kwanzaa" comes from a phrase meaning, "first fruits," in which language? The Statue of Liberty is composed of copper. The smallest particle of any amount of copper is A) an atom. B) an element. C) a compound. Eliminate D) a molecule. State one use and one disadvantage of the expansion of materials when they are heated.usedisadvantage Calculating Heat during Phase Changes question below in photo :) Describe how parenting, divorce, school, and peers may influence social and emotional development during middle childhood Which graph is defined by the function given below?y = (x-3)(x-3) pls help me now many pionts. With the consent of your parents,write a letter inviting your friend to spend part of the long vacation with you. pls help the first and correct answer get brainliest How does this event best connect to the theme "secrets isolate people"? dr. Jekyll is trapped at home because he is afraid the truth will be discovered. Dr. Jekyll feels excluded from his friends and their secrets. Dr. Jekylls friends are concerned, and they think he is physically ill. Dr. Jekylls feelings are low because he does not get enough physical activity. Part BWrite a short paragraph describing the scene and the kind of weather that you see in each picture. Use the vocabulary you've learned in thelesson What is the domain of the function?Enter your answer in the box. demos. sentences that are written in parallel construction:A. Are incorrect syntactical formationsB. intentionally oppose or contradict each otherC. are always the same lengthD. repeat or mirror each otherE. are set off from the regular text