Help with this question pls?

Help With This Question Pls?

Answers

Answer 1

The image of point A after the reflection is A'(3, -4).

The image of point B after the reflection is B'(2, -3).

To reflect a point in the x-axis, we keep the y-coordinate the same and change the sign of the x-coordinate.

For point A(3, 4):

After reflecting point A in the x-axis, the y-coordinate remains the same (4), and the sign of the x-coordinate changes.

Therefore, the image of point A after the reflection is A'(3, -4).

To reflect a point in the y-axis, we keep the x-coordinate the same and change the sign of the y-coordinate.

For point B(-2, -3):

After reflecting point B in the y-axis, the x-coordinate remains the same (-2), and the sign of the y-coordinate changes.

Therefore, the image of point B after the reflection is B'(2, -3).

Learn more about Reflection here:

https://brainly.com/question/15487308

#SPJ1


Related Questions

Write the function f(x) after the following transformation was performed:
Dilation by a factor of 16

Answers

If a dilation by a factor of 16 is performed on the function f(x), the resulting function can be expressed as f(x) * 16.

In other words, each y-value of the original function is multiplied by 16, while the x-values remain the same.

50 Points! Multiple choice geometry question. Photo attached. Thank you!

Answers

Here you would use the law of cosines.

a^2 = b^2 + c^2 - 2(b)(c)cosx

In this case we need to find the angle of f, so for a we use the length f is. It’s set up like this:

30^2 = 20^2 + 25^2 -2(20)(25)cosx

Next multiple and simply everything

900 = 1025 -1000cosx

Now subtract 1025

-125 = -1000cosx

Divide by -1000 to get cosx by itself

.125 = cosx

Now take the inverse of cos

Cos^-1 (.125)

And you get 82.8 or 83

So the answer should be A


Hope that helps. Lmk if there are questions.

What is the meaning of "formulas with free variables"?

Answers

Formulas with free variables are said to be expressions in formal logic that is known to have variables that are not bound by quantifiers.

What is the meaning of "formulas with free variables"?

Variables are placeholders with changeable values in logic. A free variable in a formula has no quantifier and can take any value.

Formula meaning varies with variable values. Formulas containing variables that are not assigned specific values are frequently employed to convey  open statements or propositions that require further specification.

Learn more about   free variables from

https://brainly.com/question/30426662

#SPJ1

In practice, we shall use in formulas other symbols, namely defined pred- icates, operations, and constants, and even use formulas informally; but it will be tacitly understood that each such formula can be written in a form that only involves and as nonlogical symbols.

Concerning formulas with free variables, we adopt the notational conven- tion that all free variables of a formula

(u1,..., Un)

are among u1, ..., un (possibly some u are not free, or even do not occur, in ). A formula without free variables is called a sentence.What is the meaning of "formulas with free variables"?

Find the area of each regular polygon. Round your
answer to the nearest tenth if necessary.
10.4
661.5
364
O 462.7
533.6
10

Answers

Area of the given heptagon = 364 square unit.

The given figure is regular heptagon,

length of each side = 10

Distance between Centre and edge = 10.4

Since we know that,

A seven-sided polygon with seven angles, seven vertices, and seven edges is known as a heptagon. They may have the same or different length dimensions. It is a closed figure, and a regular heptagon is one with all equal seven sides.

Now,

Perimeter of the given heptagon = 7x10

                                                       = 70

Area of heptagon = perimeter x 10.4/2

                              = 70 x 5.2

                              = 364

Hence,

Area = 364 square unit.

To learn more about area visit:

https://brainly.com/question/23948404

#SPJ1

Solve the compound inequality.
2y+3≥-9 or -3y<-15
Write the solution in interval notation.

Answers

To solve the compound inequality 2y + 3 ≥ -9 or -3y < -15, we'll solve each inequality separately and then combine the solutions.

First, let's solve the first inequality: 2y + 3 ≥ -9.

Subtract 3 from both sides:

2y ≥ -12

Divide both sides by 2 (note that dividing by a positive number does not change the inequality direction):

y ≥ -6

Next, let's solve the second inequality: -3y < -15.

Divide both sides by -3 (remember to reverse the inequality direction when dividing by a negative number):

y > 5

Now, let's combine the solutions. We have y ≥ -6 or y > 5.

In interval notation, we can express the solution as (-∞, -6] ∪ (5, ∞). This means that the solution includes all real numbers less than or equal to -6, as well as all real numbers greater than 5.

50 Points! Multiple choice algebra question. Photo attached. Thank you!

Answers

Answer:

C. 50 cm²

Step-by-step explanation:

The volume of a triangular pyramid is calculated using the following formula:

Volume = (1/3) * Area of the base * Height

Area of the base is the area of the triangular base of the pyramid.Height is the distance from the apex of the pyramid to the plane of the base.

For Question:

length: 5cm

Breadth:5cm

Height : 6 cm

Now,

Volume = ⅓* Area of the base * Height

Volume = ⅓*length*breadth*height

Volume= ⅓*5*5*6=50 cm³

what 2 reports could be used to verify that retirement contributions were accurately remitted for the most recent payroll period

Answers

Two reports that could be used to verify the accuracy of retirement contributions for the most recent payroll period are the Payroll Summary Report and the Retirement Contribution Report.

Two reports that could be used to verify the accuracy of retirement contributions for the most recent payroll period are:

Payroll Summary Report: This report provides a summary of the payroll transactions for the period, including details of employee wages, deductions, and employer contributions.

It should include a specific section or breakdown for retirement contributions, showing the individual employee contributions and the corresponding employer contributions.

By reviewing this report, one can ensure that the retirement contributions have been accurately calculated and remitted.

Retirement Contribution Report: This report specifically focuses on the retirement contributions made by both employees and the employer.

It should provide a detailed breakdown of the contributions for each employee, including the employee's contribution amount, the employer's matching or non-elective contribution amount, and any additional details related to the retirement plan.

This report allows for a comprehensive review of the retirement contributions to verify if they match the expected amounts based on employee records and plan guidelines.

By comparing the information in these reports with the employees' individual contribution records and the retirement plan requirements, it is possible to verify that the retirement contributions were accurately remitted for the most recent payroll period.

For similar question on Retirement Contribution Report.

https://brainly.com/question/28128413  

#SPJ8

What is the y-intercept?

Answers

Answer:

-4

Step-by-step explanation:

i jus did this question

Do the ratios 1/3 and 28/36 form a proportion?

Answers

No, they are not proportional!

No, the given two fractions/ratios do not form a proportion.

Two ratios are said to be forming proportions if and only if the reduced forms of fractions of the two ratios are the same or are equal to each other.  For example - [tex]\frac{3}{6}[/tex] and [tex]\frac{1}{2}[/tex] are in proportion because [tex]\frac{3}{6}[/tex] when reduced to the simplest form gives [tex]\frac{1}{2}[/tex] which is the same as the other given ratio.

In the given question, one ratio given is [tex]\frac{1}{3}[/tex] and the other one is [tex]\frac{28}{36}[/tex]. Reducing the second ratio to the simplest form we get [tex]\frac{7}{9}[/tex]. Clearly, the two fractions are not equal. Hence, the given two ratios are not in proportion.

Learn more about ratios and proportions -

https://brainly.com/question/29774220

Using digits 1to 9 fill in the boxes once write largest and smallest absolute value. Then find the decimal equivalent.

Answers

The decimal equivalent of the largest Absolute value, 987654321, is 987,654,321.  the largest absolute value is 987,654,321 and the smallest absolute value is 123,456,789.

The largest and smallest absolute values using the digits 1 to 9, we need to arrange them in a way that maximizes or minimizes the resulting number. Let's consider the boxes as placeholders for the digits.

To determine the largest absolute value:

We place the digit 9 in the leftmost box, as it is the largest digit among 1 to 9. Then we arrange the remaining digits, 8, 7, 6, 5, 4, 3, 2, and 1, from largest to smallest in the remaining boxes. This gives us the number 987654321, which is the largest possible number using the given digits. Therefore, the largest absolute value is 987654321.

To determine the smallest absolute value:

We place the digit 1 in the leftmost box, as it is the smallest digit among 1 to 9. Then we arrange the remaining digits, 2, 3, 4, 5, 6, 7, 8, and 9, from smallest to largest in the remaining boxes. This gives us the number 123456789, which is the smallest possible number using the given digits. Therefore, the smallest absolute value is 123456789.

To find the decimal equivalent of these numbers, we simply read the digits from left to right. The decimal equivalent of the largest absolute value, 987654321, is 987,654,321. The decimal equivalent of the smallest absolute value, 123456789, is 123,456,789.

Thus, the largest absolute value is 987,654,321 and the smallest absolute value is 123,456,789.

To know more about  Absolute value.

https://brainly.com/question/24368848

#SPJ8

50 Points! Multiple choice geometry question. Photo attached. Thank you!

Answers

Area of a polygon formula: = 2(1+[tex]\sqrt{2}[/tex]) side²

To find one side: 96 ÷ 8 = 12

implement formula

≈695.29351

4)Does this shape belong in a group of shapes that have more than one pair of
perpendicular sides?
Use the drop-down menus to explain your answer.
4) Click the arrows to choose an answer from each menu.
The number of right angles in this shape is Choose....
meet at a right angle is Choose....
perpendicular sides in this shape. This shape
shapes that have more than one pair of perpendicular sides.
. Each pair of sides that
▾ of
in a group of
.There Choose...
Choose...

Answers

No, this shape does not belong in a group of shapes that have more than one pair of perpendicular sides.

Does the shape have > one pair of perpendicular sides?

In order to determine if the shape belongs to a group of shapes with more than one pair of perpendicular sides, we need to examine the number of right angles in the shape.

A right angle is a 90-degree angle, and shapes with perpendicular sides have right angles at their intersections. By counting the number of right angles in the shape, we can determine if it has more than one pair of perpendicular sides.

If the shape has only one right angle, then it does not have more than one pair of perpendicular sides. But if it has two or more right angles, then it would belong to the group of shapes that have more than one pair of perpendicular sides.

Read more about perpendicular sides

brainly.com/question/30717455

#SPJ1

a floor that is 15 15 feet by 12 feet is being covered by tiles that are 1.5 feet by 1.5 feet. which is the best represents the number of tiles that will be needed

Answers

The best representation of the number of tiles that will be needed to cover the Floor is 80 tiles.

The number of tiles needed to cover the floor, we can calculate the total area of the floor and divide it by the area of each tile.

The area of the floor is given by the product of its length and width: 15 feet * 12 feet = 180 square feet.

The area of each tile is given by the product of its length and width: 1.5 feet * 1.5 feet = 2.25 square feet.

To find the number of tiles needed, we divide the total area of the floor by the area of each tile:

Number of tiles = (Total area of the floor) / (Area of each tile) = 180 square feet / 2.25 square feet = 80 tiles.

therefore, the best representation of the number of tiles that will be needed to cover the floor is 80 tiles.

To know more about Floor .

https://brainly.com/question/30625339

#SPJ8

A recipe calls for 3.5 cups of rice. If a cup of rice weighs 158 grams, and a bag of rice weighs 2 pounds, how many bags would be needed to make 80 recipes? (2.2 lbs. = 1 kg, 1kg = 1000 g) (Convert 80 recipes to bags)

Answers

The number of bags of rice that would be needed to make 80 recipes is 48.664 bags.

How many bags would be needed to make 80 recipes?

1 recipe = 3.5 Cups of rice

If

1 cup of rice = 158 grams

1 bag of rice = 2 pounds

2.2 lbs. = 1 kg,

1kg = 1000 g

80 recipes = 3.5 cups 80

= 280 cups

1 cup of rice = 158 grams

280 cups = 158 × 280

= 44,240 grams

1kg = 1000 g

44,240 grams = 44.24 kg

2.2 lbs. = 1 kg; x lbs = 44.24

2.2/1 = x/44.24

x = 2.2 × 44.24

x = 97.328 pounds

1 bag of rice = 2 pounds ; x bags = 97.328 pounds

1/2 = x/97.328

97.328 = 2x

x = 48.664 bags

Hence, 48.664 bags of rice is needed for 80 recipes.

Read more on recipe:

https://brainly.com/question/2985210

#SPJ1

Write in slope intercept form 6y+y=5

Answers

The equation 6y + y = 5 can be written in a slope-intercept form as y = 5/7.

We have,

To write the equation 6y + y = 5 in slope-intercept form (y = mx + b), we need to simplify the equation and isolate the y variable on one side.

Starting with the equation 6y + y = 5:

Combining the like terms on the left side gives us:

7y = 5

To isolate the y variable, we divide both sides of the equation by 7:

y = 5/7

Now the equation is in the form y = mx + b, where m represents the slope and b represents the y-intercept.

In this case, since the equation only contains the variable y and no x, the slope (m) is not present, and the y-intercept (b) is 5/7.

Therefore,

The equation 6y + y = 5 can be written in a slope-intercept form as y = 5/7.

Learn more about the equation of a line here:

https://brainly.com/question/23087740

#SPJ1

find the volume of cylinder 8in r 2in h

Answers

Answer:

402.12 or just 402

There is an upcoming election for student council president at a high school. Candidate A must get over 50% of the vote against Candidate B to be elected. A poll was taken of a random sample of 80 students from the high school and 44 students said they would vote for Candidate A. Simulations were done with an assumption that the population is split 50-50 using a sample size of 80 to see how likely a sample of 80 would have 44 who preferred Candidate A. The results of 200 simulations are shown below. Create an interval containing the middle 95% of the data based on the data from the simulation, to the nearest hundredth, and state whether the observed proportion is within the margin of error of the simulation results.

Answers

The interval containing the middle 95% of the data based on the simulation results is approximately (0.35, 0.65), and the observed proportion of 0.55 falls within this interval, indicating that it is within the margin of error of the simulation results.

To create an interval containing the middle 95% of the data based on the simulation results, we can calculate the lower and upper bounds of the interval.

Let's analyze the simulation results and find the appropriate values.

Out of 200 simulations, we observe that the proportion of students who preferred Candidate A ranges from a minimum of 0.35 (35%) to a maximum of 0.65 (65%).

Since the simulations assume a 50-50 split, we can consider these values as the lower and upper bounds for the middle 95% of the data.

To find the range of the middle 95% of the data, we calculate the difference between the upper and lower bounds.

Upper bound: 0.65

Lower bound: 0.35

Range: 0.65 - 0.35 = 0.30  

To find the interval containing the middle 95% of the data, we divide the range by 2 and add/subtract it from the midpoint.

The midpoint is the average of the upper and lower bounds.

Midpoint: (0.65 + 0.35) / 2 = 0.50

Range / 2: 0.30 / 2 = 0.15

Lower bound of the interval: 0.50 - 0.15 = 0.35

Upper bound of the interval: 0.50 + 0.15 = 0.65

Therefore, the interval containing the middle 95% of the data based on the simulation results is approximately (0.35, 0.65).

Now let's compare the observed proportion from the poll to this interval. The poll indicates that out of a random sample of 80 students, 44 students said they would vote for Candidate A.

To calculate the observed proportion, we divide the number of students who preferred Candidate A (44) by the sample size (80).

Observed proportion: 44/80 = 0.55

The observed proportion of 0.55 is within the margin of error of the simulation results.

It falls within the interval (0.35, 0.65), indicating that the observed proportion is consistent with the simulation and aligns with the assumption of a 50-50 split in the population.

For similar question on interval.

https://brainly.com/question/17097944  

#SPJ8

pleaseseee help


Two one-step equations
Two equations that contains fractions
One equation with distributive property
One equation with decimals
One real-world problem that is solved by an equation
Remember that each equation must include at least one variable

pls help 100 points

Answers

Answer:

Step-by-step explanation:

Change these fractions into decimals. Do not round your answers:
a. 3 8
b. 1 9

Answers

Step-by-step explanation:

3/8 = 0.375

1/9 = 0.1111111111

Answer:

Step-by-step explanation:

The consistency of the diameters of wheel bearings is vital to the operation of the wheel. The specifications require that the variance of these diameters be no more than 0.0015 centimeter squared. The diameter is continually monitored by the quality-control team. Twenty subsamples of size 10 are obtained every day. One of these subsamples produced bearings that had a variance of 0.00317 centimeter squared. Conduct a hypothesis test to determine if the quality control team should advise management to stop production and search for causes of the inconsistency of the bearing diameters. Use a significance level of 0.05.

Answers

hm i’m not rlly sure but it should be correct although who knows above might be

In the figure below, S is the center of the circle. Suppose that JK = 20, LM = 3x + 2, SN = 12, and SP = 12. Find the
following.

Answers

Answer:

x = 6
JN = 10

Step-by-step explanation:

if the values of SN and SP are the same, so are the corresponding sides next to the right angles.
which means:
if SP = SN, then JK = LM.
Use the reverse version of the function for calculating LM (3x + 2).
-2 * 1/3
Now apply that function to 20.
(20-2)/3
= 18/3
= 6.
x = 6
Now JK is a chord.
and Radius SQ intersects JK at a perpendicular right angle (at point N).
So JN would be half the length of JK.
20/2 = 10.
JN = 10

Which graph represents the solution set to the system of inequalities?

{ Y ≤ 1/4X-2
Y ≥ −54X+2

ANSWER Down Below

Answers

The graph of the system of inequalities:

y  ≤ (1/4)*x - 2

y  ≥ −(5/4)x +2

Is in the image at the end.

Which is the graph of the system of inequalities?

Here we have the system of inequalities:

y  ≤ (1/4)*x - 2

y  ≥ −(5/4)x +2

To graph this, we just need to graph both of the linear equations, and we need to shade the region below the first line (the one with positive slope) and the region above the second line, the one with negative slope.

Then the graph of the system of inequalities is the graph you can see in the image at the end of the answer.

Learn more about system of inequalities at.

https://brainly.com/question/9774970

#SPJ1

Help Quickly! A truck needs 7 gallons of fuel to travel 56 miles. Can the truck travel 48 miles with 6 gallons of fuel? Explain.

Giving brainliest

Answers

Yes, 7/56 and 6/48 are proportional because 7×48 = 56×6. Therefore, the correct answer is option B.

Given that, a truck needs 7 gallons of fuel to travel 56 miles.

The truck travel 48 miles with 6 gallons of fuel.

Here, the proportion is

7:56::6:48

We know that, the proportion is product of extremes = product of means

7×48 = 56×6

336 = 336

Therefore, the correct answer is option B.

To learn more about the proportional relationship visit:

brainly.com/question/12917806.

#SPJ1

Two cars leave towns 850 kilometers apart at the same time and travel toward each other. One car's rate is 16 kilometers per hour less than the other's. If they meet in 5 hours, what is the rate of the slower car? Do not do any rounding.

Answers

Answer:9.5

Step-by-step explanation:

Find the area of the following rectangle. a = 12 ft b = 14 ft A = ft 2

Answers

Answer:

The area of the rectangle is 168 ft².

Step-by-step explanation:

Formula: A = lw

where l and w are the length and width of the rectangle respectively.

We're given with the length and the width as

a = 12 ft

b = 14 ft

Let's solve for the area using the formula above.

A = lw

A =  12ft(14ft)

A = 168 ft²

find the quotient of 5/31 divided by 15/23

Answers

Answer:23/93.

Step-by-step explanation:

Compare the functions shown below:

f(x)

polynomial graph with x intercepts at negative 3, negative 2, 1, 2, y intercept at negative 12
g(x)

trig graph with points at 0, 3 and pi over 2, 0 and pi, negative 3 and 3 pi over 2, 0 and 2 pi, 3

Over the interval x = 0 to x = 2π
h(x) = 2x3 − 2x2 − 3x + 2


Which function has the most x-intercepts? (2 points)

f(x)

g(x)

h(x)

All three functions have the same number of x-intercepts.

Answers

The function f(x) has the most x-intercepts, with five x-intercepts at -3, -2, 1, 2, and the y-intercept at -12. The function g(x) has only three points given, and therefore cannot be determined how many x-intercepts it has. The function h(x) has at most three x-intercepts, which can be found by graphing or using calculus techniques. Therefore, the correct answer is:

f(x)

Answer:

f(x) has the most x intercepts

The top of a kitchen table measures 160cm by 90cm. A beetle walks diagonally across the table from one corner to the other. Calculate how far the beetle walks.

Answers

Answer: To calculate the distance the beetle walks diagonally across the table, we can use the Pythagorean theorem, which states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides.

In this case, the two sides of the right triangle formed by the table are 160 cm and 90 cm. Let's call the hypotenuse (the distance the beetle walks) "d."

So, applying the Pythagorean theorem, we have:

d^2 = 160^2 + 90^2

Simplifying:

d^2 = 25600 + 8100

d^2 = 33700

Taking the square root of both sides:

d ≈ √33700

d ≈ 183.54 cm

Therefore, the beetle walks approximately 183.54 cm diagonally across the kitchen table.

Given the geometric sequence where a1 = −9 and the common ratio is 5, what is the domain for n?

Answers

The domain for n in the given Geometric sequence is the set of positive integers: {1, 2, 3, 4, 5, ...}.

In a geometric sequence, each term is obtained by multiplying the previous term by a constant value called the common ratio (r).

In the given geometric sequence, the first term (a1) is -9 and the common ratio (r) is 5. Therefore, the sequence can be written as:

-9, -9 * 5, -9 * 5^2, -9 * 5^3, ...

To determine the domain for n, we need to determine the values of n for which the sequence is defined. In a geometric sequence, the term number n represents the position of a term in the sequence.

In this case, the first term corresponds to n = 1, the second term corresponds to n = 2, and so on. The domain for n consists of all the positive integers starting from 1, as the sequence extends indefinitely.

Therefore, the domain for n in the given geometric sequence is the set of positive integers: {1, 2, 3, 4, 5, ...}.

the domain does not include zero or negative values, as these positions in the sequence do not exist. The sequence only starts from the first term (n = 1) and continues indefinitely in the positive integer domain.

To know more about Geometric .

https://brainly.com/question/29632351

#SPJ8

100 Points! Geometry question. Photo attached. Find x, y, and z. Please show as much work as possible. Thank you!

Answers

The missing sides of the triangle are

x = 6.32

y = 7.48

z = 11.83

How to find the missing sides of the triangles

The missing side x is calculated using similar triangles rules as below

x / 10 = 4 / x

cross multiply gives

x² = 40

x = √40 = 6.32

Other sides will solved by Pythagoras theorem.

the formula of the theorem is

hypotenuse² = opposite² + adjacent²

plugging the values as in the problem

let y be the required distance

y² = 6.32² + 4²

y² = 55.94

y = √55.94

y = 7.48

z² = 6.32² + 10²

z² = 139.94

z = √139.94

z = 11.83

Learn more on Pythagoras theorem here:

https://brainly.com/question/29241066

#SPJ1

Other Questions
construct a huffman code for the following string: accggtcgagtgcgcggaagccggccgaa describe your tree, the codeword, and the number of bits required to encode the string. g What is the solution to the equation? 1/2n +3 =6 Bradley and Sons' income statement included the following data: Sales $ 350 000 Cost of goods sold = $120 000 Administrative expenses = $40 000 Depreciation = $20 000 Interest expense = $10 000 If the corporate income tax rate is 20%, what is the firm's net income? What happened because of the following instances? Answer with complex sentence. Remember to place a comma after the dependent clause when used at the beginning of the sentence.1.What resulted because everybody respected each other?2.What resulted because everyone did his job?3.What resulted when all the parents took good care of their children?4.What will happen when every child shares a toy with those who do not have any? anna throws a ball toward marco, her 4-year-old son, and he tries to hit it with a bat. she observes that marco is unable to hit the ball even after several tries. when she writes something on a blackboard, he seems to find it difficult to copy it. anna also notices that he often seems to bump into things. in this scenario, marco's brain is most likely facing a problem related to the process of: A Bank with the following capital levels: common equity of 47,000, Tier 1 of 38,000, Tier 2 of 17,000. If total assets are 850,000 and risk adjusted assets are 650,000, the capital classification of the bank is the lifetime of a certain electronic component is a random variable with an expectation of 6000 hours and a standard deviation of 120 hours. what is the probability that the average lifetime of 500 randomly selected components is between 5990 hours and 6010 hours? answer the following questions before computing the probability. Find f(x)/g(x) F(x)= x3+6x2+x1/2 wen is performing a cost-benefit analysis (cba). he needs to determine whether the organization should move workloads from the in-house data center to the cloud. the projected benefit is $50,000. the cost of the control is $1,500. what is the control value? 2x Consider the rational expression 3x + 10x +3 A B 1. Write out the form of the partial fraction expression, i.e. factor 1 factor 2 2. Clear the resulting equation of fractions, then use the "wipeout" method to find A and B. 3. Now, write out the complete partial fraction decomposition. + What are some of the programs and projects of the local government in your community that should be planned during dry season and wet season?Explain. What lasting impacts or contributions came from child labor during the Industrial Revolution? 7 sentences or more PLEASE (4-5)(4+5)211where a and b are integers.Writein the formFind the values of a and b. Let C be the curve which is the union of two line segments, the first going from (0, 0) to (4, -3) and the second going from (4, -3) to (8, 0). Compute the line integral So 4dy + 3dx. A 5-2 Evaluate the indefinite integral by using the given substitution to reduce the integral to standard form. 15r2 dr u=3-r 3 3-r (9 points) Find the directional derivative of f(x, y, z) = yx + z4 at the point (2,3,1) in the direction of a vector making an angle of some with V f(2,3,1). f = Speculating on a company's credit risk, an investor should purchase (protection buyer) a credit default swap if they expect the company's credit risk to deteriorate.True/False ? Kim was asked to _ E _ _ _ E R a speech at graduation Let +E={(1,0,2) : 05 : 05 65 1, Os zs 1, 7725 rs 7). Compute , SIDE yze(x2+x2) dv. Let L(c) be the length of the parabola f(x)=x? from x = 0 to x=C, where c20 is a constant. a. Find an expression for L and graph the function. b. Is L concave up or concave down on [0,00)? c. Show tha