How do you think
the cell of a unicellular
organism compares to
that of a multicellular
organism? Give 2
examples

Answers

Answer 1
Unicellular organisms don’t contain membrane-bound organelles, while the cells of multicellular organisms contain membrane-bound organelles such as the nucleus. In a unicellular organism, the cell carries out all cellular processes, while in the cell of a multicellular organism, different cells have different jobs.

Related Questions

The graph shows the change in seabird mortality rates in New Zealand waters due to illegal, unreported, and unregulated fishing (IUU) and the implementation of bycatch remediation measures in 2004. What conclusion can be made about the impact of the remediation measures that were used?

Illegal and unregulated fishing practices continue to cause increases in bird bycatch numbers, in spite of the new measures.
Legal fishing practices have caused the new remediation measures to become more effective.
The measures virtually eliminated all of the bird bycatch.
The measures used showed very little impact on the overall seabirds caught in fishing lines.

Answers

According to the graph, the measurements practically eliminated all incidental captures, as shown in the third answer option.

What does the graph show?Illegal capture practices show a high performance between 1997 and 2003.Illegal capture practices show a low performance from 2004 and this performance tends to fall in the next years until it presents very low values.Legal capture practices maintain a balanced performance.

The decrease in the performance of illegal practices from 2004 onwards, shows how the remediation measures were efficient in reducing the activity of these practices and providing a better environmental well-being.

More info about graphics on the link:

https://brainly.com/question/14323743

Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms​

Answers

Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

What is social media?

Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.

Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Learn more on social media here,

https://brainly.com/question/3653791

Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>

Answers

Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

How human impacted the environment?

Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.

So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

Learn more about environment here: https://brainly.com/question/17413226

At the molecular level, how do scientists know a new species has arisen?

Answers

Answer:

DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.

Explanation:

? :-)

Look at the tropical grassland ecosystem.

Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.

There are more zebra than the carrying capacity of the pictured ecosystem. This represents a

climax community
biological surplus
peak phenomenon
sigmoid phenomenon

Answers

Answer:

It is B Biological Surplus

Explanation:

Biological Surplus means that a species population has grown too big, above carrying capacity

At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.

Answers

Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.

What is a Food web?

This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.

90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.

Read more about Food web here https://brainly.com/question/2179

Which animal phylum was the first to develop a dorsal nerve cord a backbone?

Answers

Answer:

Chordates?

Explanation:

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

Which type of rock would most likely be found near the landform shown in the picture? ​

Answers

Answer:

Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .

Explanation:

Have a Nice day!!  :D

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (

Answers

How does a missense mutation affect the function of a protein?

A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.

So basically how do i ask my best friend out?

Answers

Answer:

Explain

well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself

What that determines if a cell is eukaryotic. *

Answers

To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
there’s not any answer choices, but eukaryotic cells possess a clearly defined nucleus. they also have more organelles

Define nondisjunction. Is this a beneficial process? Explain.

Answers

Answer:

Nondisjunction occurs when chromosomes fail to segregate during meiosis; when this happens, gametes with an abnormal number of chromosomes are produced. The clinical significance is high: nondisjunction is the leading cause of pregnancy loss and birth defects

Explanation:

What is salinity and how does it change?.

Answers

A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.

Salinity is controlled by a balance between water removed by evaporation and freshwater added by rivers and rain. changes in evaporation and rainfall, ocean currents, melting ice, and freshwater influx from rivers or streams can influence patterns of sea surface salinity, making some regions saltier and other regions fresher over time.

describe how energy is transferred through a food chain


PLSS ANSWER IM BEGGING YOU

Answers

Well energy is transferred between organisms in food webs from producers to consumers. The energy is used by organisms to carry out complex tasks. The vast majority of energy that exists in food webs originates from the sun and is converted (transformed) into chemical energy by the process of photosynthesis in plants.on:

Answer:

Energy is passed between organisms through the food chain. Food chains start with producers. They are eaten by primary consumers which are in turn eaten by secondary consumers. They are then eaten by tertiary consumers and in a long food day these can be eaten by quaternary consumers.

VIDA chart for biology

Answers

Answer:

Yes you are right I didn't get the question too.

Which compounds are not soluble in water?

Answers

answer :

All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)

Exceptions :

Salts of NH4 +, and the alkali metal cations

Answer:

All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides

Explanation:

why is it beneficial for scientists to understand how other organisms are able to edit which proteins are created

Answers

Answer:

Genome editing technologies enable scientists to make changes to DNA, leading to changes in physical traits, like eye color, and disease risk

Explanation:

Describe the different internal and external factors that affect human health.

Answers

Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.

Explanation:

the peripheral nervous system is involved in
A. voluntary but not involuntary, actions
B. both voluntary and involuntary actions
C. involuntary but not voluntary actions​

Answers

Answer:

B. Both voluntary and involuntary actions

Answer:

b both voluntary and involuntary actions

Explanation:

peripheral nervous system is the whole system which is composed of voluntary actions ( by purpose actions eg. running) and involuntary actions ( natural actions eg. heartbeat)

What material is the objective lens made of in UV fluorescence microscopy

Answers

Answer:

quartz

Explanation:

Why is over farming a threat to the health of humans?

A.
It decreases the use of fertilizer.

B.
It increases the production of food.

C.
It adds too many new nutrients to the soil.

D.
It removes too many nutrients from the soil.

Answers

Answer:

it removes too many nutrients from the soil.

Explanation:

Explanation:

it can increas the health risk

Name the five carbon sugar in a DNA neucleotide

Answers

deoxyribose is the 5carbon sugar found in DNA nucleotides

The Earth’s rotation is the only thing that impacts wind

Answers

Answer:

false

Explanation:

While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.

Answer:

False

Explanation:

This is false because the earth goes one way but the wind can go all kinds of ways

How have hominid skulls changed over time? What are some of the reasons for those
changes?

Answers

Answer:

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Explanation:

Give brainlist me please

Skull and face changes define modern humans - Harvard Gazette

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land

Answers

Answer:

I believe the answer is farming

Answer:

having a wildlife environment

Explanation:

I took the test and this was the correct answer so your welcome

Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.

Answers

Answer:

C

Explanation:

It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer:

C

Explanation:

Other Questions
let a and b be the roots of the equation x^2 - 3x - 1 = 0. Find a^3 + b^3hint: a^3 + b^3 = (a+b)(a^2-ab+b^2)URGENT PLEASE b= c= Please help I need to do this asap What is the central control center for energy balance and weight management?. based on your experience discuss a real-life example where organization behaviour was very useful for you. then imagine and discuss what was to happen if organizational behaviour was not utilized in this situation Explain at least two factors that contribute to the development of aggression. include at least one strategy that can be used to cope with aggressive impulses.explain altruism according to the social exchange theory. be sure to include an example that demonstrates why a person may choose to behave in an altruistic way. The equation 4x 45 = y is used to find your profit, y, in dollars from buying $45 of supplies and washing cars for $4 each. What does the x stand for? I need help please... :) Thank you so much The fixed budget indicates direct labor costs of $27,500. Actual direct labor costs were $27,000. The variance is: 23.-28. In a manner similar to Example 1, (a) identify input andoutput consistent with the general proportional model; (b) writean equation for the model; (c) determine a numerical value for theconstant k; and (d) solve the problem.23. The maximum distance that you can see from the top of a tallbuilding is (directly) proportional to the square root of theheight of the building. You can see approximately 41 mi fromthe Canadian National Tower lookout level, which is 1,135 fttall. How far can you see from the top of the Sears Tower inChicago (now the Willis Tower), which is 1,454 ft tall?23. How far can you see from the top of the sears tower in Chicago, which is 1,454 ft tall? 1s22s22p63s23p3what element does this represent Please help I have a meeting with my teacher and one of the study guide questions is "how can we interpret fractions" please help i'm giving 40 points and ill also give brainliest if you could just explain what it means HELP ME OUT PLS!!!!!!!2) The rotational periods of four planets are listed in the table. Which of these planets has the SHORTEST day? A) Earth B) Jupiter C) Saturn D) Uranus Arsenic-74 is used to locate brain tumors. It has a half-life of 17.5 days. 90 mg wereused in a procedure. Write an equation that can be used to determine how much ofthe isotope is left after x number of half-lives.How much would be left after 70 days? please help me ( if you get it right i will rate you 5/5) Which sentence uses a comma or commas correctly?I need chicken lettuce guacamole, tortillas, and cheese to make my taco.Violets, roses, lilacs, and tulips bloomed in Robbies garden.It can be difficult to know when to use commas semicolons, or dashes.Buddy delivered cupcakes, eclairs, cannolis, and, cookies. The scores at a golf course recorded last year followed a normal distribution with mean 78 andstandard deviation 11. you choose an srs of 15 scores and calculate xbar = mean score. which ofthe following are the mean and standard deviation of the sampling distribution of x bar? ?How can friends, family members, or teammatesincrease the likelihood of you reaching your goals? how did scientific revolution lead to the revolutionary war A ball that has a mechanical energy of 65 J haas 10 j of kinetic energy. The ball has j of potential energy How can stasis questions help you when you are creating an argument?Question 3 options:a) Stasis questions can help you identify fallacies of reasoning that interfere with the logic of your argument.b) Stasis questions can help you build common ground with your audience so that the argument is more persuasive.c) Stasis questions can help you increase your credibility so that your audience is more inclined to believe your argument.d) Stasis questions can help you identify the question at the heart of your argument, making it easier to see whether the question has been adequately answered.