If a tRNA molecule has an anticodon which reads CAG, what was the codon on the mRNA molecule?
(4 points)
answers:
AUG
GTC
UAG
GUC

Answers

Answer 1

Answer:

GUC

Explanation:

The base sequence for tRNA will be the complement of the mRNA sequence:

tRNA: CAG

mRNA: GUC

Answer 2

Answer:

GUC

Explanation:


Related Questions

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

What is the difference between a molecule and a diagram of a molecule ?

Answers

Answer: The molecule itself is the actual thing present.

while the diagram explains what makes up a molecule or what it looks like structurally

Explanation:

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

Explain which processes take place during meiosis that lead to variation in inherited traits.

Answers

Answer:

We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.

What environment does ambulocetus live in?

Answers

Answer:

northern Pakistan, in long-lost coastal shallow seas and brackish rivers

Explanation:

i'm hoping this is right

.
Why are some sources of sugar better than others?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]

Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable

Answer:

Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.

How do I calculate a heart rate?

Answers

Explanation:

To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.

which statement describes what happens with ATP during glycolysis?

A) more ATP is produced than is used

B) glycolysis splits ATP

C) more ATP is used than is produced

D) glycolysis does not make any ATP

Answers

Answer:

A. more ATP is produced than used

Explanation:

Regulation of glycolysis

Several steps in glycolysis are regulated, but the most important control point is the third step of the pathway, which is catalyzed by an enzyme called phosphofructokinase (PFK). This reaction is the first committed step, making PFK a central target for regulation of the glycolysis pathway as a whole^1  

1

start superscript, 1, end superscript.

PFK is regulated by ATP, an ADP derivative called AMP, and citrate, as well as some other molecules we won't discuss here.

ATP. ATP is a negative regulator of PFK, which makes sense: if there is already plenty of ATP in the cell, glycolysis does not need to make more.

AMP. Adenosine monophosphate (AMP) is a positive regulator of PFK. When a cell is very low on ATP, it will start squeezing more ATP out of ADP molecules by converting them to ATP and AMP (ADP + ADP \rightarrow→right arrow ATP + AMP). High levels of AMP mean that the cell is starved for energy, and that glycolysis must run quickly to replenish ATP^2  

2  squared.

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

At which type of technonic plate boundary is a volcano least likely to occur​

Answers

Answer:  A

coz its just sliding one another

Hope it is correct

^_^

!!pls help!!

taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?

A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores

Answers

the answer is D) herbivores

Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.

What do you mean by herbivores?

A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.

Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.

Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.

Learn more about herbivores:

https://brainly.com/question/16786804

#SPJ2

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

What happens to excess carbohydrates in animals?
They are stored as fat.
They are stored as protein.
They are stored in nucleic acids.
They are stored as sugar.

Answers

Answer:

A-They are stored as fat.

Explanation:

In animals, the excess of carbohydrates or glucose is first converted into glycogen (polysaccharide) through the process called glycogenesis. ... When glycogen reservoirs are saturated, excess carbohydrates, as well as proteins, are converted into fats which are then majorly stored in adipose tissues.

the answer would be they are stored as fat :)))

biological macromolecules are organized into four main categories. What type of macromolecule contains phosphorus as part of a phosphate group?
1.) lipids
2.) proteins
3.) nucleic acid
4.) carbohydrates

Answers

Answer:

3.) nucleic acid

Explanation:

Biological macromolecules can be defined as a very large molecule (structure) that comprises of covalently bonded organic atoms and smaller molecular structures (monomers).

Biological macromolecules are organized into four main categories and these includes;

I. Lipids: these categories of biological molecules is mainly made up of fats and it is responsible for providing the body with long-term energy.

II. Carbohydrates: it is contained in energy-giving foods and it aids the functioning of the muscles, nervous system and other organs found in the body.

III. Proteins: it contains amino acids and it is responsible for maintaining the functioning of the body system.

IV. Nucleic acid: it comprises of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) which are the genetic codes (blueprints) for living organisms.

Hence, the type of macromolecule that contains phosphorus as part of a phosphate group (sugar 2-deoxyribose) is nucleic acid.

From the biological macromolecules, Nucleic acids contains phosphorus as part of a phosphate group.

Nucleic acids are biopolymers, macromolecules, crucial for all known types of life. Nucleotides, which are the monomer components, make up their structure. a sugar with five carbons, a phosphate group, and a base with nitrogen. Deoxyribonucleic acid and ribonucleic acid are the two main types of nucleic acids.

Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two types of nucleic acids that carry genetic information that is read by cells to create the RNA and proteins that allow living things to function.

Know more about nucleic acids:

https://brainly.com/question/11737667

#SPJ6

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

A student was asked the following question on her biology final exam
question : how do organisms grow in size
her answer : “organisms grow in size when the cells within the organism grow larger. As the cells grow larger the organism grows larger as well
Explain why her answer is not correct then explain how she should have answered the question

Answers

The cell can grow large but not the organisms. Once the cell is growing the organisms grow smaller. I think hope it correct

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Other Questions
what is Use the table to solve the inequality 2x If one strand of the DNA molecule has a base sequence with 8 nucleotides, how many nucleotides will the complementary base sequence contain? * What part of Europe did Ottoman Empire control during most of the Middle Ages?Southern Europe, including what is now SpainO Western Europe, including what is now FranceEastern Europe, including what is now TurkeyO Northern Europe, including what is now Germany El registro o documento de las inmunizaciones o vacunas que ha recibido una persona se denomina ________. Write in slope intercept: slope=2/3 y-intercept =-1 A student made the table shown to list some contact and non-contact forces.Examples of ForcesContact Forces Non-Contact ForcesThe force exerted by a stretched spring The force applied by Earth and sun on each otherThe electrical force exerted by a positive charge on a negative charge Magnetic attraction between two magnetsWhich statement best explains why the table is incorrect? Spring force is a force acting at a distance. Electrical force is not a contact force. Gravitational force can act between planets and sun only when they are in contact. Magnetic attraction is a contact force The type of selection where the characteristics on both extremes are selected against is plz answer asap I rlly need help Hw help please ASAP+10PTS What do the events in paragraph 2 indicate about Grandpa? scary tales Choose the Sentence that is Gramatically Correct 1. Vosotros gustis comer mariscos.2. A vosotros os gustan comer mariscos.3. Vosotros os gustis comer mariscos.4. A vosotros os gusta comer mariscos. solve the proportion 10/4=15/x which is bigger 5.8 or 5.5 Probation is a ________________ punitive legal disposition for delinquent youths. ple help. 30 pts, do NOT steal points or get REPORTED ):choice options.===Slider 10134===Slider 29101316 whats the slope? thanks if you help me :) who was the president on hidden figures True or False: As civilization advanced, our literary heroes acquired more human-like flaws. SOMEONE PLEASE HELP!!! THIS IS MY LAST QUESTION!!! A 12-foot ladder is placed 4 feet away from a house as shown.A 12 foot ladder is leaning against a house to form angle x. The distance between the house and the bottom of the ladder is 4 feet. The angle between the house and the ground is 90 degrees.What is the value of x, rounded to the nearest degree?x According to the manufacturer, if the angle the ladder forms with the ground, x, is between 70 and 75, then it meets safety standards.Is this ladder being used safely? Steam Workshop Downloader