Answer: They all need each other to live.
Answer: Different types of organisms in an ecosystem need each other to live; they are interdependent.
Explanation:
Interdependent = (Two or more) living Organisms that depend on each other to survive, grow and reproduce.
Mark my answer as the brainliest!up to 25% of a cell's atp is used to run sodium-potassium pumps. without the resulting sodium and potassium gradients, neurons and muscles cannot fire properly. if a person is poisoned with cyanide, they cannot generate atp, and die within a few minutes. in relation to the sodium-potassium pump, what specific impact would cyanide have on concentrations across the cell membrane?
Cyanide depolarizes the peritubular cell layer by +18.8 +/ - 2.3 mV/10 min in the presence and by +4.5 +/ - 0.9 mV/10 min without even a trace of the luminal substrate.
Hydrogen cyanide is a poisonous little nonpolar particle that is delivered by certain plants to discourage herbivores. Cyanide crosses layers and restrains a critical cycle in the breath.
The cyanide particle, CN, ties to the iron molecule in cytochrome C oxidase in the mitochondria of the cells and goes about as an irreversible protein inhibitor. This keeps cytochrome C oxidase from doing what it needs to do, which is to send electrons to oxygen in the electron transport chain of high-impact cell breath.
To learn more about Cyanide depolarizes here
https://brainly.com/question/13030946
#SPJ4
The oxygen consumed during cellular respiration is a DIRECT participant in what process? Exclude the four processes that are indirectly linked to oxygen consumption in cellular respiration A. phosphorylation of ADP to form ATP B. accepting electrons from sugars in glycolysis C. accepting electrons at the end of the mitochondrial electron transport chain D. accepting electrons from the components of the citric acid cycle
E. removing electrons from NADH
A DIRECT participant in accepting electrons at the conclusion of the mitochondrial electron transport chain is the oxygen used during cellular respiration. So, C is the best choice.
In this procedure, oxygen molecules act as the ultimate electron acceptor by receiving electrons from electron carriers like NADH and FADH2. As a result, water is created and a proton gradient is created, both of which are used to fuel ATP synthase's synthesis of ATP.
Indirect links between oxygen consumption and cellular respiration include the phosphorylation of ADP to form ATP, the uptake of electrons from sugars in glycolysis, the components of the citric acid cycle, and the removal of electrons from NADH.
Learn more about oxygen,
https://brainly.com/question/2272415
#SPJ4
even though sickle cell confers no advantage in the malaria-free u.s., african americans have a relative high incidence of the gene. this is an example of
Even though sickle cell confers no advantage in the malaria-free U.S., African Americans have a relatively high incidence of the gene. This is an example of genetic drift.
What is genetic drift?The phenomenon in which gene frequencies shift randomly in small populations is known as genetic drift. A change in the frequency of a gene in a population due to random sampling is referred to as a genetic drift. The loss of one allele and an increase in another is an example of genetic drift.
What are some examples of genetic drift?Some examples of genetic drift are as follows:
When a small community splits off from a larger population and forms a new colony, the original gene pool is typically not represented in the new colony's gene pool.
When a tiny group of animals is forced to cross a natural obstacle like a river, the animals that survive are often genetically distinct from the original population.
Generally speaking, genetic drift has a more significant impact on smaller populations than on larger populations. There are two types of genetic drift: founder effects and population bottlenecks.
Here you can learn more about genetic drift
https://brainly.com/question/12086252#
#SPJ11
Subject: Science
1. Approximately how far away would the formation of Earth be if you used the scale from your timeline?
2. Which events helped life develop on Earth? ''Explain''.
Because several meteorites have been dated, the Earth's age has increased from 4.55 0.3 billion years in 1956 to 4.55 0.02 billion years. I) The synthesis of nucleotides and amino acids.
How did life on Earth start to appear?In rocks that are 3.7 billion years old, the oldest known life forms, microbes, have left their imprint. The signals were made up of a specific class of carbon molecules produced by living things.
What process created the Earth?Formation. Over a period of 4.5 billion years, whenever the solar system was still in its current configuration, the second planet from the Sun—Earth—was created when gravity drew spinning gas and dust in. Earth has a solid crust, a high degree of crystallinity, and a central core, just like its sibling terrestrial planets.
To know more about nucleotides visit:
https://brainly.com/question/30299889
#SPJ1
which name is given to the phase of the hair growth cycle where the hair falls out?
The phase of the hair growth cycle where the hair falls out is Telogen phase.
The hair growth cycle is the process by which hair grows and falls out, and it involves three stages. The three stages are the anagen, catagen, and telogen phases. The hair growth cycle is a natural process that happens in three stages.
The three stages are:
Anagen phase: The anagen phase is the active growth phase of the hair follicle. It is the period during which the hair grows actively. The anagen phase lasts between 2 and 7 years and is different for each individual.
During the anagen phase, the hair root is firmly implanted in the scalp, and it receives nutrients and oxygen through the blood vessels.
Catagen phase: The catagen phase is the transitional phase of the hair growth cycle. This phase typically lasts between 2 and 3 weeks and is a period of transition from the anagen phase to the telogen phase.
During the catagen phase, the hair stops growing, and the follicle shrinks.
Telogen phase: The telogen phase is the resting phase of the hair growth cycle. During this phase, the hair is fully formed and does not grow.
The telogen phase lasts between 2 and 4 months, and at the end of this phase, the hair falls out.
To know more about Telogen phase, refer here:
https://brainly.com/question/30267882#
#SPJ11
when assessing newborns for chromosomal disorders, which assessment would be most suggestive of a problem?
dna is double-stranded, but for each protein, only one of these two strands is used to produce an mrna transcript. what is the coding strand called?
The coding strand of DNA is also known as the sense strand or the positive strand.
It is called the coding strand because it contains the same sequence of nucleotides as the mRNA molecule that is produced during transcription. In other words, the coding strand has the same sequence as the mRNA, except that it has thymine (T) instead of uracil (U) since mRNA uses uracil instead of thymine.
The other strand of DNA, which is not used as a template for mRNA synthesis, is called the non-coding strand or the antisense strand, as it has a complementary sequence to the coding strand. During transcription, RNA polymerase reads the antisense strand and produces an mRNA molecule that is complementary to it, which is why it is called the template strand.
So, to summarize, the coding strand is the strand of DNA that has the same sequence as the mRNA transcript that is produced during transcription.
to know more about DNA refer to :
https://brainly.com/question/264225?referrer=searchResults
describe how darwins ideas have been updated. be sure to mention the role of natural selection in modern eveolutionary theory
Darwin's ideas about evolution were based on his observations of plants and animals.
The theory of natural selection is now seen as the cornerstone of evolutionary theory, which explains how populations evolve over time.The following are some of the ways in which Darwin's ideas have been updated:Genetics and Evolutionary Theory: Modern evolutionary theory incorporates genetics, which helps explain how new traits arise in populations and how they are passed down through generations.
The genetic variation that exists within populations provides the raw material for natural selection, which acts on these differences and allows populations to evolve over time. Molecular Biology: In the twentieth century, molecular biology allowed scientists to study the molecular basis of life, including the structure and function of DNA.
This has helped scientists understand how genetic changes occur, and how they are passed down through generations. Genetic drift, which occurs when random events cause changes in the frequency of traits within a population, is another mechanism that can drive evolutionary change.
Natural selection is still the most important mechanism driving evolutionary change, but genetic drift can also play a role. Gene Flow: Gene flow, which occurs when individuals from one population migrate into another and breed with members of that population, can also drive evolutionary change.
This can introduce new traits into a population and increase genetic variation.Natural Selection and Evolutionary Theory: Natural selection is still the most important mechanism driving evolutionary change, but it is now seen as one of several mechanisms that can act on populations.
Other mechanisms, such as genetic drift and gene flow, can also play a role. Overall, modern evolutionary theory has expanded on Darwin's ideas and has incorporated new discoveries in genetics and molecular biology to provide a more comprehensive understanding of how populations evolve over time.
Learn more about Darwins theory here:
brainly.com/question/25718754
#SPJ11
1. in what kinds of environments would you expect to find the greatest predominance of c3, c4, and cam plants? how can you explain the co-occurrence of 2, or even 3, of these types of photosystems in one area?
C3 plants are the most common type of plants and are found in moderate temperature environments with average precipitation. Examples of C3 plants include wheat, soybeans, and rice.
C4 plants are better adapted to hot and dry environments, such as tropical and subtropical areas. Examples of C4 plants include corn, sugarcane, and sorghum.
CAM (crassulacean acid metabolism) plants are found in arid environments such as deserts, where they can reduce water loss by opening their stomata at night and closing them during the day. Examples of CAM plants include cacti and succulents.
The co-occurrence of two or even three types of photosynthetic pathways in one area can be explained by the different adaptations of these plants to different environmental conditions. For example, in areas with variable environmental conditions, multiple types of plants may be present, each with different photosynthetic pathways to maximize their ability to survive and thrive in that environment.
Additionally, certain plants may be better adapted to different microclimates within the same general area, leading to the co-occurrence of multiple types of photosystems in the same region.
Learn more about photosynthetic pathways at: https://brainly.com/question/20936971
#SPJ11
Which part of a bone such as the femur prevents the skeleton from becoming
too heavy?
A. The compact bone tissue
B. The spongy bone tissue
C. The bone marrow
D. The growth plate
Answer:
B
Explanation:
Spongy bone reduces the weight of the skeleton and reduces the load on muscles. Spongy bone, also known as cancellous bone or trabecular bone, has increased porosity and less mineral content compared with cortical (compact) bone.
which of the following is considered the greatest challenge facing science and society? multiple choice climate change pollution loss of biodiversity habitat loss
Among the following options, climate change is considered the greatest challenge facing science and society.
Climate change is a long-term change in the average weather patterns that have come to characterize Earth's local, regional, and global climates over the past several decades.
The term also encompasses wider impacts caused by this alteration of nature, such as glacial melt, sea level rise, and shifting weather patterns. In recent years, global climate change has been widely regarded as one of the most significant environmental and social problems of our time.
Scientists warn that the climate is rapidly changing due to human activities such as fossil fuel combustion, deforestation, and other human-induced changes to the landscape.
Climate change is causing severe impacts, such as sea-level rise, stronger hurricanes and other extreme weather events, and increasing temperatures.
These impacts are affecting our society, from impacting our homes and neighbourhoods to influencing our health, food security, and economy.
Therefore, climate change is considered the greatest challenge facing science and society.
To know more about climate change, refer here:
https://brainly.com/question/28779953#
#SPJ11
Find the amino acid chain that forms from the mRNA sequence DNA
sequence below.
GATCGATACCATTCGGCGCATACTTCG
Answer:
mRNA= CUA GCU AUG GUA AGC CGC GUA UGA AGC
Amino acid chain=LEU ALA MET VAL SER ARG VAL STOP SER
Explanation:
Find the START codon (AUG). Start reading in groups of 3 and check against a codon table. When you get to a STOP (UAA, UAG, UGA) you’ve got that protein strand’s sequence.
Which best describes a hurricane?
A
a low-pressure weather system
B
a high-pressure weather system
C
a cold front
D
a stationary front
Answer:
your answer is: A hope this helps
Explanation:
the provided structure is an aldehyde substrate derivative that specifically inhibits elastase. which elastase active site residue forms a covalent bond with the aldehyde inhibitor?
The aldehyde substrate derivative that specifically inhibits elastase forms a covalent bond with a serine residue in the active site of elastase.
Aldehydes are a class of organic compounds that have a carbonyl group at the end of their carbon chains, denoted as -CHO. Aldehydes have a polar carbonyl group and a nonpolar hydrocarbon region, making them highly reactive. Aldehydes are classified as primary, secondary, or tertiary based on the degree of substitution of the carbon atom attached to the carbonyl group. Elastase is a serine protease enzyme that breaks down elastin, a major protein component of connective tissue in the body, resulting in the disassembly of elastic fibers. Elastase is secreted by neutrophils, monocytes, macrophages, and fibroblasts, among other cells. It plays a vital role in wound healing and inflammation. The aldehyde inhibitor binds to the active site of elastase and forms a covalent bond with a serine residue. The serine residue is part of the catalytic triad (His, Asp, and Ser) that aids in the breakdown of peptide bonds. The covalent bond formed between the aldehyde inhibitor and the serine residue in the elastase active site is irreversible, resulting in enzyme inhibition. Therefore, the serine residue forms a covalent bond with the aldehyde inhibitor.Learn more about aldehyde: https://brainly.com/question/17101347
#SPJ11
during the menstrual cycle, what triggers ovulation to occur? question 23 options: a gradual decrease in estrogen levels. inhibin b sharply spikes. a surge in progesterone occurs. activin is released.
Ovulation is triggered by a surge in progesterone which occurs during the menstrual cycle.
This surge is caused by the follicle stimulating hormone, which is produced by the pituitary gland. The FSH encourages the growth of follicles in the ovaries, which produce estrogen. As the follicle matures, estrogen levels peak. The peak in estrogen causes the brain to secrete luteinizing hormone, which triggers the follicle to rupture and release an egg (ovulation). Activin, inhibin B, and a gradual decrease in estrogen levels are all part of the process that precedes and follows ovulation. Activin is a hormone secreted by the ovaries, which helps to mature follicles.
Inhibin B is a hormone secreted by the ovaries, which is thought to help control the amount of FSH in the body and in turn the number of follicles that mature. A gradual decrease in estrogen levels occurs as ovulation approaches and during the luteal phase of the menstrual cycle. This decrease in estrogen helps to prepare the body for the next menstrual cycle.
To know more about progesterone click on below link:
https://brainly.com/question/12732603#
#SPJ11
which of the following characteristics apply to all species in kingdom protista? group of answer choices eukaryotic unicellular heterotrophic possess cell walls aquatic
The following characteristics apply to all species in the kingdom Protista is eukaryotic. All species in Kingdom Protista are eukaryotic, meaning they have a membrane-bound nucleus and other organelles in their cells.
None of the following characteristics apply to all species in the Kingdom Protista:
Heterotrophic: Some protists are heterotrophic (i.e., they obtain their nutrition from other organisms), but some are autotrophic (i.e., they produce their own food through photosynthesis).Possess cell walls: Some protists have cell walls, but not all. Some have cell membranes only.Aquatic: While many protists are aquatic, some are found in soil, or in the bodies of other organisms.Learn more about Kingdom Protista: https://brainly.com/question/15377222
#SPJ11
In humans, how has that term been historically modified?
In humans, the term "race" has been historically modified. This term has been used to categorize people into different groups based on their physical characteristics such as skin color, hair texture, and facial features.
However, this categorization has been found to be biologically meaningless as there is more genetic variation within these groups than between them. Additionally, this categorization has been used to justify discriminatory practices such as slavery, segregation, and genocide.
Therefore, it is important to recognize the flawed nature of this term and move towards a more inclusive and equitable understanding of human diversity. This can be achieved through promoting cultural awareness, celebrating differences, and recognizing the humanity of all individuals regardless of their physical characteristics.
See more about humans in:
https://brainly.com/question/1370317
#SPJ11
what is the role of the 5' cap on a eukaryotic mrna molecule? multiple select question. it facilitates the exit of mrna from the nucleus. it allows the mrna to bind to a ribosome for translation. it is recognized by rna polymerase to allow the initiation of transcription. it enables the spliceosome to identify the first exon.
The answer to the question is A and B - it facilitates the exit of mRNA from the nucleus and it allows the mRNA to bind to a ribosome for translation.
The role of the 5' cap on a eukaryotic mRNA molecule is to allow the mRNA to bind to a ribosome for translation and it facilitates the exit of mRNA from the nucleus. The 5' cap is a necessary feature of eukaryotic mRNA molecules that aids in their translation. The 5' cap, which is a chemically modified nucleotide added to the 5' end of the mRNA during RNA processing, provides a variety of benefits for the mRNA molecule.
The 5' cap helps to shield the mRNA molecule from RNA-degrading enzymes in the cytoplasm, as well as to promote the ribosome's binding to the mRNA molecule. It also aids in the initiation of protein synthesis by facilitating the formation of a complex between the mRNA, ribosome, and initiator tRNA.
Finally, the 5' cap aids in the process of splicing the mRNA molecule to remove non-coding introns. The 5' cap of eukaryotic mRNA also helps to distinguish between self and non-self RNA. By identifying the 5' cap, host cells may differentiate between their own mRNA and foreign mRNA.
Thus, the 5' cap serves as a molecular "passport" that identifies the mRNA molecule as genuine and necessary for the cell's normal functions.
Therefore, the correct option is A and B.
To know more about translation, refer here:
https://brainly.com/question/28943852#
#SPJ4
fred had chicken pox as a child. which of his cells confer immunological memory to the chicken pox virus?
Answer:A lymphocyte (B or T cell) that retains a “memory” of a specific pathogen after an infection is over and thus provides immunity to the pathogen.
Explanation:
during conjugation, the donor cell generally retains a copy of the genetic material being transferred. this is termed a blank process
Answer:
Conservative
Explanation:
During conjugation, the donor cell generally retains a copy of the genetic material being transferred. This is termed a conservative process.
a malignant disease characterized by an uncontrolled production of lymphocytes would be abbreviated as
A malignant disease characterized by an uncontrolled production of lymphocytes would be abbreviated as CLL.
What is CLL?
CLL is the abbreviation for chronic lymphocytic leukemia, which is a blood and bone marrow disease. CLL is a type of cancer that starts in the bone marrow and progresses through the bloodstream into other tissues and organs.
CLL is a slow-growing cancer that affects white blood cells called B-lymphocytes, causing them to multiply uncontrollably.
Leukemia is a cancer of the blood that originates in the bone marrow, the soft, spongy tissue in the center of the bones. The bone marrow produces red blood cells, platelets, and white blood cells, which are necessary for good health.
CLL, like all blood cancers, interferes with the bone marrow's ability to make enough healthy blood cells. It can result in a decrease in the number of red blood cells, causing anemia, as well as a decrease in the number of platelets, resulting in bleeding and bruising.
Learn more about Leukemia here:
https://brainly.com/question/21806829#
#SPJ11
leucine aminopeptidases (laps) are found in all living organisms and have been associated with the response of the marine mussel, mytilus edulis, to changes in salinity. laps are enzymes that remove n-terminal amino acids from protein
Leucine aminopeptidases (LAPs) are a group of enzymes found in all living organisms, including the marine mussel Mytilus edulis. These enzymes play a crucial role in protein metabolism by catalyzing the cleavage of N-terminal amino acids from protein substrates.
LAPs have been implicated in a variety of physiological processes, including protein turnover, regulation of peptide hormone levels, and immune system function. In Mytilus edulis, LAPs have been shown to play a role in the organism's response to changes in salinity. When the salinity of their environment changes,
Mytilus edulis utilizes LAPs to modify the composition of proteins in their cells, allowing them to better adapt to the changing conditions. This adaptation is important for the organism's survival, as changes in salinity can significantly affect the functioning of cells and tissues.
Overall, LAPs are versatile enzymes that play a critical role in protein metabolism and are found in a wide range of living organisms, including the marine mussel Mytilus edulis. Their ability to modify protein substrates makes them important players in many physiological processes, including adaptation to changing environmental conditions.
For more details about aminopeptidases click here:
https://brainly.com/question/7175239#
#SPJ11
which of the following is not one of the ways of studying and identifying microorganisms?staining culture animal culture human inoculation
The following is not one of the ways of studying and identifying microorganisms is Animal culture.
Microorganisms can be studied and identified through the following ways:
Staining Culture
Human Inoculation
Animal culture
Staining is a method of dyeing microorganisms to make them visible under a microscope. The process of staining involves the use of chemicals that color certain components of the cell, such as the cell wall, nucleus, or cytoplasm, so that they can be seen more clearly.Culture is a method of growing microorganisms in a lab, usually in a nutrient-rich liquid or solid medium. By observing the growth patterns of the microorganisms, scientists can identify them and determine their properties, such as their size, shape, and metabolic processes.
Human inoculation is the method of studying microorganisms by exposing human subjects to a pathogen under controlled conditions in order to observe how the body responds to the infection. This method is useful in understanding how diseases spread and how they can be treated or prevented.
Animal culture is not a method of studying and identifying microorganisms. However, animal models can be used to study the effects of microorganisms on living organisms, such as the symptoms they cause, the immune response they elicit, and the ways they can be treated.
Here you can learn more about Animal culture
https://brainly.com/question/30273504#
#SPJ11
During crossing over, when the invading strand uses the invaded DNA as a _____, this automatically results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected _____ ratio.
The correct answer is: During crossing over, when the invading strand uses the invaded DNA as a template, this automatically results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected 1:1 ratio of crossing over.
Explanation:
DNA is replicated through the process of crossing over, which involves the exchange of genetic material between two homologous chromosomes. During the process, one of the homologous chromosomes acts as the invading sequence, while the other acts as the invaded DNA. When the invading strand uses the invaded DNA as a template, it results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected 1:1 ratio of crossing over.
What is crossing over?
Crossing over is a process during meiosis where the chromosome arms of maternal and paternal homologous chromosomes swap DNA sections (recombination) to produce new allelic combinations of traits. The crossing-over process starts with the breakage of two homologous chromosomes, the migration of the broken ends toward each other, and the formation of crosslinks by the formation of single crossovers.
These crosslinks are eventually converted to chiasmata that keep the chromosomal arms connected until metaphase I. During this process, one chromosome might lose genetic material while the other might acquire genetic material. This event results in unique combinations of genes that might not be present in either parent. The frequency of crossovers is affected by the distance between the gene and the centromere. Chromosomes that are nearer to the centromere are less likely to cross over than those that are further away. Explaining the departure from the expected Mendelian ratio.
The ratio of offspring created by a cross that exhibits the dominant and recessive traits that Mendel observed is referred to as the Mendelian ratio. Crossing over might result in new allelic combinations of genes that deviate from the Mendelian ratios. This is because the transmission of genes is no longer controlled by a single gene pair on a chromosome. Chromosome segregation is disturbed in one way or another by crossovers.
To know more about crossing-over process, visit:
https://brainly.com/question/11347292
#SPJ11
when dna probes are used to identify bacterial dna similarities by hybridization, the probe dna is heated and the template dna is treated to separate the 2 strands. why would the probe dna be heated?
Answer:
The probe DNA is heated to denature or separate the two strands of the double-stranded DNA to make it single-stranded. This is because hybridization, the process of joining two complementary strands of DNA, can only occur between two single-stranded DNA molecules. By heating the probe DNA, it denatures and becomes single-stranded, allowing it to hybridize with the target DNA under specific conditions. The temperature at which the denaturation or melting occurs depends on the base composition of the DNA, specifically the amount of G-C pairs. This is known as the melting temperature or Tm.
How many grams of neutral red would your instructor have used to create 100ml of a 4% w/v stock solution? ____ gm
Answer:0.0012
Explanation: 0.03×x/100
kenyatta is participating in a research study examining the effects of a particular hormone. after she is given the hormone, she engages in behaviors that demonstrate trust in strangers, peer bonding, and group cohesion. kenyatta was
The hormone that Kenyatta was given is oxytocin as she encounters behavior that indicates trust in strangers and peer bonding.
What is oxytocin?Oxytocin is often referred to as the "trust hormone" or "bonding hormone" because it plays a role in social behavior and emotional bonding. It is known to promote trust, social bonding, and positive interactions with others.
Oxytocin is released naturally in the body during various social activities such as positive social interactions. In research studies, the administration of exogenous oxytocin has been associated with increased trust, social bonding, and group cohesion, which aligns with the behaviors exhibited by Kenyatta in the study.
Therefore, the hormone that is given to Kenyatta is oxytocin.
Learn more about oxytocin, here:
https://brainly.com/question/1996049
#SPJ6
Your question is incomplete, most probably the full question is this:
Kenyatta is participating in a research study examining the effects of a particular hormone. after she is given the hormone, she engages in behaviors that demonstrate trust in strangers, peer bonding, and group cohesion. Kenyatta was given which hormone?
growth hormone, secreted by the gland, stimulates growth of bones and muscle by activating intermediary proteins called
Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called growth factors. Growth factors are molecules that bind to receptors on the surface of target cells.
Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called STATs (signal transducers and activators of transcription). It has been shown that signaling pathways are crucial to the regulation of growth hormone (GH) in terms of both its secretion and actions.
The signaling pathways used by the GH receptor involve a number of intermediary proteins that interact with the receptor and allow it to carry out its functions. Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called STATs (signal transducers and activators of transcription).
These STAT proteins then activate a number of transcription factors that are responsible for the production of various genes that control growth. As a result of this signaling pathway, GH is able to promote growth in both bone and muscle tissues.
Read more about the bones here:
https://brainly.com/question/412179
#SPJ11
where does hemopoiesis occur? yellow bone marrow epiphyseal line red bone marrow nutrient foramina endosteum
Answer:
Red bone marrow
Explanation:
Hematopoiesis that occurs in your bone marrow is called medullary hematopoiesis. Blood cells get made in your bone marrow and released into your bloodstream. Less often, hematopoiesis takes place in other parts of your body, like your liver and spleen. Hematopoiesis that occurs outside of your bone marrow is called extramedullary hematopoiesis.
In adults, hematopoiesis of red blood cells and platelets occurs primarily in the bone marrow. In infants and children, it may also continue in the spleen and liver.
Please help quick I’ll mark brainly
Why does the Northern hemisphere produce more CO2 overall? Why does it absorb more CO2 certain times of year?
Answer:
The Northern Hemisphere produces more CO2 overall for several reasons. One main reason is that it contains more land area and therefore more vegetation that undergoes photosynthesis, which takes in CO2. However, during the winter months, when the temperature drops, the vegetation goes dormant and stops absorbing CO2. At the same time, human activity, such as burning fossil fuels and heating buildings, tends to increase during the winter months, which leads to an increase in CO2 emissions. As a result, the Northern Hemisphere experiences seasonal variations in CO2 levels, with higher levels during the winter months and lower levels during the summer months when vegetation is actively growing and absorbing CO2. Additionally, the Northern Hemisphere experiences more seasonal variation in general, with more extreme temperatures and weather patterns that can affect the balance of CO2 in the atmosphere.