In an if/then statement, what is the "then” part called?
a. hypothetical proposition
c. consequent
b. antecedent
d. inference

Answers

Answer 1
A. a hypothetical proposition
Answer 2
Answer:

A

Explanation:

It’s what the other guy said

Related Questions

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?

Answers

Answer: Stabilization selection

Explanation:

Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

For recessive trait to be expressed you need to receive the allele from both parents. True or false

Answers

Answer:

When a trait is recessive, an individual must have two copies of a recessive allele to express the trait.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

what is the meaning of
•molecule
•compound
•atom
•element
•organic compound
•inorganic compound​

Answers

Molecule: a molecule is the smallest particle in a chemical element or compound that has the chemical properties of that element or compound. Molecules are made up of two or more atoms that are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons among said atoms. Although oxygen is an element, it naturally has 2 atoms (O2), because it is a halogen and in order to reach 8 valence electrons and become stable and unreactive, it bonds with another oxygen atom. This means that oxygen atoms and oxygen molecules are different; one is an element, the other is a molecule.

Pure Substance: can be divided into two sub-categories: compounds and elements.

Compound: A chemical compound is a chemical substance composed of many identical molecules composed of atoms from more than one element held together by chemical bonds. A molecule consisting of atoms of only one element is therefore not a compound, meaning that oxygen molecules (O2) are NOT compounds. NaCl, or table salt, is.

Atom: An atom is the smallest unit of ordinary matter that forms a chemical element. Every solid, liquid, gas, and plasma is composed of neutral or ionized atoms.

Element: An element is a pure substance consisting only of atoms that all have the same numbers of protons in their atomic nuclei. Elements are the base, more "pure" of the pure substances. Each element is assigned a symbol. Perhaps the most recognizable of them is H, for hydrogen.

Organic Compounds: organic compounds are generally any chemical compounds that contain carbon-hydrogen bonds. The study of these is called organic chemistry. I mean, carbon is the basis of ALL known life.

Inorganic Compounds: They are any substance in which two or more chemical elements (usually other than carbon) are combined, nearly always in definite proportions. Compounds of carbon are classified as organic when carbon is bound to hydrogen. THE OPPOSITE OF ORGANIC COMPOUNDS.

Chemistry is fun!! Hope this helps!! Have a wonderful day!!

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

22. What do you think is the best solution for fighting climate change? (Answer
should be a minimum of 3 sentences).

Answers

Answer:

Adopting sustainable and environment friendly practices

Explanation:

Sustainable and environment friendly practices allows an individual to use available resources without depleting them and hence even the future generations have adequate supply of natural resources. Afforestation and conservation of water resources specially the potable  water sources need to be started immediately with massive force.

The cell cycle is the life of the cell from the time it is first formed from a dividing parent cell until its own division into two cells

Answers

Explanation:

cell cycle is made up of three main parts: interphase, mitosis, and cytokinesis. Most biologists agree that interphase makes up the period of time that a cell would be preparing for cell division. Cells spend the majority of their lives in this stage. During interphase a cell is going to be growing, replicating its genetic material and essentials to carry out cell division, and proofreading the genetic material to ensure replication has occurred correctly. This doesn’t sound like much, but it’s actually the longest part of the cell cycle. Once this is complete, the cell will then go through cell division and, theoretically, split into two new cells (cytokinesis).

How cytokinesis works will depend upon the type of cell that is dividing. Here is an image that summarizes the differences in cytokinesis in plant cells and animal cells, which is the classic example used in many introductory biology courses:

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

Once in an organism, what are these atoms used for?

Answers

Atoms are the basic building blocks of ordinary matter. Atoms can join together to form molecules, which in turn form most of the objects around you. Atoms are composed of particles called protons, electrons and neutrons.

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

Which of these represents an individual form of life such as an animal, plant, or single-celled life form?

Organ
Organism
Organ system
Tissue

Answers

Organism is the answer.
organism!! hope that helps

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

Will mark brainliest there’s a button for the pic

Answers

I'd say FLPE is the worst. It can run high temperatures but it's not safe and not safe with all foods, it's has a high cost.

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

True or false The sea otter is considered a keystone species that influences the survival of many other species in an ecosystem .

Answers

Answer:

false

Explanation:

answer: True

kind of

Other Questions
what is the image of the point (-2,7) after a rotation of 180 degrees counterclockwise about the origin? Please help I'm struggling a line passes through point (-10,3) and has a slope of 1/2. write an equation in Ax+By=C form for this line. Use integers for A, B, and C How did the surrounding seas affect Japan's development A piece of string is 120 centimeters long.How long would the piece of string measure in meters?. please help omg- AAAAAAAAAAAAAAAAAAAAA please help me with full calculations The Nazis looked at Jews as thisinstead of a religion in pcr,a. the gene sequence is determinedb. multiple copies of the dna sample are madec. dna is destroyed so it has no value In a survey of 554 U.S. adults, it is found that 360 favor a ban on stem cell research. Set up the null and the alternative hypotheses to test whether there is sufficient evidence that over 61% favor a ban on stem cell research. If alpha is set to 3.0%, should the null hypothesis be rejected Which have lower densities, liquids or gases? Why? FIRST ONE TO ANSWER CORRECTLY GETS A KISS ^^ a concerto______ is a type of concerto for a group of soloists rather than just one Before WWII started weremost European countriescommunist or democratic? Terry rents a kayak while he is on vacation. He is required to pay a deposit of $95 plus an additional $11.50 per day. Terry only has $150 to spend on kayaking. Write and solve an inequality you can use to determine the maximum number of days Terry can afford to rent a kayak. MFK Corp. wants to raise capital and is considering an offer of bonds and debentures. It is not sure of a particular disclosure requirement, so MFK poses its question to the SEC and requests an interpretation letter. If the SEC issues an interpretive letter addressing MFK's question and MFK follows the statements contained in the letter, MFK cannot be penalized should the advice be incorrect.a. Trueb. False Solve w = x + for y.Reply really fast and give like the work for it too please Someone help me with this pls Help me pls ........... The City of Irvine upgraded a bicycle lane in a section of road to have a physical barrier between the cyclists as opposed to just a painted white line on the road. They now want to do a study to see if the bicycle lane upgrades have encouraged more people to utilize the bike lane. Before the upgrade, on any given day, it was known that the section of road saw an average of 350 unique cyclists. After the upgrade, they took a random sample of 35 days in the year and counted the number of unique cyclists each day. The average was 405 cyclists with a standard deviation of 25. Test the hypothesis at the 0.05 significance level.