Joaquim fell his severely breaking his arm. The break is so bad that the bone is sticking out of the skin. The paredes concerned that the will become infected. Which statement best describes the first responders conce​

Joaquim Fell His Severely Breaking His Arm. The Break Is So Bad That The Bone Is Sticking Out Of The

Answers

Answer 1

Answer:

Just based on common sense, its either C or D. I would guess C but not 100% sure sorry.

Explanation:

Answer 2

I think it is A or C

This person needs bone fracture repair.


Related Questions

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

Why might parents who don't show the trait of albinism have children who do?

Answers

Answer:

This trait is rare when it occurs. Some genes depend on other genes to be expressed, so in most cases a trait is denied an expression. But its still there, so it passes down to generation until it gets expressed.

Explanation:

Answer:

Because it's a recessive trait

Explanation:

There are two chromosomes that determine your biological sex: XX for the female and XY for the male. You inherit one X chromosome from your mother and one X or Y chromosome from your father, which is what determines your sex.

A certain inheritable genetic condition can be recessive or dominant. If it's dominant, it shows even if just one chromosome carries that condition. If it's recessive, it has to be in both ones (or just the x one or just y if you're male. That's why some conditions, such as daltonism, affect men more that women).

For example, blue eyes are a recessive trait, brown eyes are a dominant trait. If your parents are both blue eyed, you will surely have blue eyes as well. The same can't be said if both of your parents have brown eyes: they might still be carrier of the blue eyed trait (both of them have to), in which case you would have a 25% chance (1/4) to have blue eyes (½ to inherit the carrier chromosome from your mother; ½ from your father). The same can be said about albinism

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

Why did the size of the caribou population decrease?

Answers

Answer:

The herds have been declining in recent decades due to a complicated mix of factors including hunting, disease, diminished food availability, and climate change, the report explains.

Which of the following is NOT an example of a biotic factor in an ecosystem?
F.
Grasses
G.
Bacteria
H.
Beetle
J. Water

Answers

the answer is h. beetle

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

Describe some of the changes in the land and in life-forms that occurred at the end of the Paleozoic Era.

Answers

during the end of the paleozoic era it was probably one of the greatest mass extinctions on earth and the land started to break up and move around to form what the world looks like today

Many closely related species of ducks have different courtship dances that are performed to solidify a pair-bond. If you were to cross individuals from each of these species what would you expect to see in the hybrid offspring if behaviors related to pair-bond formation were completely due to genetics?

Answers

Answer:

I would expect to see a new phenotype in which the new duck hybrid species would express a new mixed courtship dance with the behaviors of both parentals.  

Explanation:

The cross between both parentals, each from different species, might produce a new phenotype that exhibits both parental dances. The new dance might be considered a hybrid of the parental dances.

Genetically speaking, we can think that there is a gene codifying for the courtship behavior in one species and another gene expressing a different courtship behavior in the other species. This cross´ product would be a hybrid species that exhibits a part of both parentals´ behaviors.

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

Please help ASAP!!!
In the formation of pollen grains, the nucleus in the pollen will divide by mitosis to form two nuclei. Justify.​

Answers

Answer:

The other two, the generative nuclei, can be thought of as non motile sperm cells. After reaching an ovule and breaking out of the pollen tube tip, one generative nucleus unites with the egg cell to form a diploid zygote.

Explanation:

This means that;

The fertilized egg with two complete sets of chromosomes, one from each parent. The zygote undergoes a limited number of divisions and gives rise to an embryo.

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

Consider the following chemical reaction: Hb + O2 → HbO2 When this reaction is going from right to left, what process is occurring?

O a. oxygen unloading

O b. cellular respiration

O c. pulmonary ventilation

O d.oxygen loading

Answers

Answer: A, Oxygen Unloading

The average number of individuals of the same species per unit of area or volume at a given time is the
population's
O carrying capacity,
O birth rate.
O size.
Odensity.
O distribution.
Next >

Answers

Huhhhhhhhhhhhhhhhhhhhhhhhh

P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structured hierarchy. Multicellular organisms are organized from the simplest to most complex: cells, tissues, organs, organ systems, organisms. Evaluate the model above. Select ALL of the statements that accurately depict the examples shown in the model. A) R shows an animal cell. B) O shows types of tissue. P shows organs in the endocrine system. D) P shows an organ system, the digestive system. E) S shows an organ system, the digestive system.​

Answers

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

Answer:

A) R → Q → P → S

Explanation:

I just took the test on USA Test Prep

What nitrogen base does Cytosine pair with

Answers

Answer:

Guanine

Explanation:

There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine)

Adenine always bonds with thymine, and cytosine always bonds with guanine.

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

identify the function of the vacuole. what is the funtion of the vacuole. please explain​

Answers

food vacuole or granule:- used to contain food for digestion .

contractile vacuole :- used to remove excess water.

follow me .....☺️☺️☺️nice study

Answer:

vacuole store water nutrients and other materials and in plants support the cell structure.

Explanation:

The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence does not show any?

Answers

There is biogeography comparative and anatomy and comparative embryology and molecular biology

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

Lungs, Trachea, Diaphragm, Nose: Which organ system do these belong to?
Circulatory
Excretory
Digestive
Musculoskeletal
Respiratory

Answers

Answer:

Respiratory

Explanation:

they all come together and help with breathing and oxygen :)

Answer: respiratory system

Explanation:

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

What are Tectonic Plates made of and what do they do?

Answers

Answer:

They move

Explanation:

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere.Plate tectonics move because they are carried along by convection currents in the upper mantle of the planet (the mantle is a slowly flowing layer of rock just below Earth's crust). Hot rock just below the surface rises and when it cools and gets heavy, it sinks again.

Explanation:

Other Questions
What happens to a community when the same bad things happen over and over again? pls help will give branlyest What kinds of reasons should you include in your report?reasons that experts give in their articles or interviewsall of theseyour personal experiences with the topicfacts that support your main ideas Why is it dangerous to have electric appliances near you when you are taking a bath? Will give brainliestNO LINK SHARING OR U WILL BE REPORTEDAfter an initial infection of the measles virus, B-cells recognize the measles virus in your body. How is this helpful in human immune response? (SC.912. L.14.52)wsO The B-Cells transfer this recognition to T-cells, which will then devour the viruseso The B-cells use this recognition to defend the body against the B-cells more quickly recognize and respond to any other virus that invades the bodyO The B-Cells more quickly recognize the response to any other virus that invades the bodyO The B-cells produce antibodies more quickly if the measles virus is encountered again your most exciting day of school A substance whose shape can easily change is aa.solid.b.powder.c.fluid.d.metal.Please select the best answer from the choices providedABCD Canberra Company uses a job order cost accounting system. During the current month, the factory payroll of $180,000 was paid in cash. The amount of labor classified as direct labor was three times greater than the amount classified as indirect labor. What amount should be debited to Factory Overhead for indirect labor for this month 6. Markets with elastic supply and demand curves: a) Have demand and supply curves that never intersect. B) Are very sensitive to a change in price. C) Have greater movements in quantity than prices. D) Are very sensitive to a change in quantity. E) Are only theoretical and do not exist in the real world. 5. Find the circumference of a circle with a radiusof 15 feet. The following amount was assigned to each. A penguin was $9, an octopus was $36, and ant was $27. Based on this information, how much will be given to a pig? Which shows the Commutative Property of Addition?A 2 (5+6)=2 (5) + 2(6)B 3+ (7+ -2) = 3 +(-2+ 7)C 13+ (-13) = 0D-9+(3+4)= (-9 + 3) + 4 What is the highest office in the Executive Branch? Writing an Informative Essay about Heroic Qualities 1. What type of angle am I?m Which of the following accurately describes how environmental pollution can cause anon-transmissible disease?People who are exposed to photochemical smog in "gray-air cities" are at risk of developingpneumonia.People who are exposed to increased levels of tropospheric ozone are at risk of developingskin cancer.People who eat animals in which toxins have bioaccumulated are at risk of contractingmalaria.People who are exposed to asbestos particles are at risk of developing respiratoryinfections. At 5 am, the temperature was -10F. By noon the temperature was 7F, What Integerrepresents the change in temperature from 5 am, to noon? Employers should be concerned with helping employees cope with both job-related stress and off-the-job stress. Do you agree or disagree? Discuss. HELP ME PLEASE15 points and brainliest if right What are air masses, and how do they work?NEED HELP ASAP! Based on James Thurber's quote, a reader could infer which of the following?questions are pointless when they cannot be answeredthe process of asking questions is more important than answering themthe process of answering questions is more important than asking themit is good to know some answers to questions Steam Workshop Downloader