List and briefly describe at least 5 fine motor skills and at least 5 gross motor skills that you've used within the last few days.

Answers

Answer 1

5 fine motor skills are typing, writing, cutting, zipping, threading and 5 gross motor skills that you've used within the last few days are walking, running, jumping, throwing, catching.

What is motor skills?

Motor skills are the physical abilities that involve movement of the body and its parts. These skills involve coordination, control, dexterity, and balance. Motor skills can be divided into two categories: gross motor skills, which involve the larger movements of the body, such as running and jumping, and fine motor skills, which involve the smaller movements of the body, such as picking up an object or writing.

Fine Motor Skills:

1. Typing - Using my fingers to type on a keyboard.

2. Writing - Using a pen or pencil to write words or draw pictures.

3. Cutting - Using scissors to cut shapes or designs.

4. Zipping - Using my fingers to zip up a zipper.

5. Threading - Using my fingers to thread a needle.

Gross Motor Skills:

1. Walking - Moving my legs to walk from one place to another.

2. Running - Moving my legs quickly to cover a greater distance.

3. Jumping - Using my legs to propel myself up and off the ground.

4. Throwing - Using my arms to throw a ball.

5. Catching - Using my arms and hands to catch a ball.

To learn more about motor skills

https://brainly.com/question/20292222

#SPJ1


Related Questions

Jeannie was studying heredity and drew the illustration shown below.

Image

What is Jeannie showing with the dark lines inside each cell?

Answers

Anything that can be seen inside the nucleus of a cell. Proteins and DNA are organised into genes, which form a chromosome.

What are chromosomes and how many are there?

Chromosomes—threadlike structures made up of protein and a single DNA molecule—are used to carry genetic information from cell to cell. Chromosomes are housed in the nucleus of cells in both plants and animals, including humans.

Each cell normally has 23 pairs of chromosomes. Chromosomes, according to Sutton and Boveri's Chromosomal Theory of Inheritance, are the means by which genetic inheritance is conveyed. Rather, chromosomal behaviour includes segregation, independent assortment, and, on rare occasions, linkage; neither Mendelian genetics nor gene linkage are completely true.

To know more about chromosome visit:

brainly.com/question/1596925

#SPJ9

Explain Continental Drift Hypothesis (pangaea and Sea Floor Spreading (Hess)

Answers

Answer:

The Continental Drift Hypothesis, proposed by Alfred Wegener in 1912, suggests that the Earth's continents were once joined together as a single supercontinent called Pangaea. According to the hypothesis, Pangaea began to break apart around 200 million years ago and its pieces slowly drifted to their present positions over millions of years.

Wegener's theory was based on several lines of evidence, including the fit of the continents, the distribution of fossils, and the matching of rock types and mountain ranges across different continents. However, at the time, he was unable to explain the mechanism by which the continents moved.

In the 1960s, the theory of sea floor spreading was proposed by Harry Hess, which provided an explanation for the movement of the continents. Sea floor spreading is the process by which new oceanic crust is formed at mid-ocean ridges and then moves away from the ridge, carrying the continents with it.

According to the theory of sea floor spreading, the Earth's lithosphere (the rigid outer layer of the Earth) is divided into a series of tectonic plates that move slowly over the underlying mantle. As magma rises to the surface at mid-ocean ridges, it cools and solidifies to form new oceanic crust. As this new crust forms, it pushes the existing crust away from the ridge, causing the continents to move.

The evidence supporting the theory of sea floor spreading includes the distribution of magnetic stripes on the ocean floor, which suggest that the Earth's magnetic field has reversed itself many times in the past. These magnetic reversals are recorded in the rocks on either side of the mid-ocean ridges, providing evidence for the movement of the tectonic plates.

Overall, the Continental Drift Hypothesis and the theory of sea floor spreading provide a compelling explanation for the movement of the Earth's continents over millions of years.

5. Earthquakes can cause millions of dollars in damage and can lead to injuries or death.
A. Name two types of damage that can be caused by an earthquake. (2 points)
B. How does an earthquake cause each of these types of damage? (2 points)

Answers

Answer:

A. Two types of damage that can be caused by an earthquake are structural damage and landslides.

B. An earthquake causes structural damage by shaking the ground, which can cause buildings, bridges, and other structures to collapse or sustain damage. Landslides can occur when the ground is shaken loose and gives way, causing soil and rocks to slide downhill. This can damage homes, roads, and other infrastructure in the affected area.

Explanation:

2) Table 7.1 shows the results of a study which compared the decomposition of dead D 6.0 ASSIGNMENT-2023 Use data from table 7.1 to support your answer. 2670 Compare the enzyme activity at location A with the enzyme activity at location B.​

Answers

In comparing the enzyme activity of the two locations; at location A, the cellulase activity is higher than at location B, while the protease activity is slightly higher at location A.

What is the comparison of the two locations?

At location A, the protease activity is 2750 µmol min-1 and the cellulase activity is 4790 µmol min-1, while at location B, the protease activity is 2670 µmol min-1 and the cellulase activity is 2500 µmol min-1.

The difference in soil pH at the two locations could be due to variations in the types of vegetation, amount of rainfall, or human activities such as pollution or acid rain deposition.

The difference in soil water content at the two locations could be due to variations in the amount of rainfall, soil drainage, or the proximity to a water source such as a river or lake.

Learn more about soil pH at: https://brainly.com/question/13941039

#SPJ1

Complete question:

Table 7.1 shows the results of a study comparing the decomposition of dead leaves at two locations A and B.

                                              location A location B

protease activity / µmol min– 1 2750       2670

cellulase activity / µmol min–1 4790       2500

soil pH                                      6.0              3.5

soil water content / %              10                  77

(i) Compare the enzyme activity at location A with the enzyme activity at location B

ACADEMIC STUDY ON NATURAL SELECTION, THIS IS NOT A TEST!!!

Answers

Answer is A. Wild population

Anyone know how to solve this? It's biotechnology haha.

Answers

Based on the gel results, patient A has lower levels of the protein corresponding to standard IV in their blood.

The protein that is different in patient B is the one corresponding to the band that did not match with any of the standards. The fact that the band on the gel for patient B was smaller in size compared to the control band suggests that the protein is of smaller molecular weight than the standard.

What is the significance of the results of the protein levels for patients  A and B?

Since these are essential blood proteins, the difference in protein levels for both patients may have implications for their health.

For patient A, lower levels of the protein corresponding to standard IV may indicate a potential health issue related to the function of that protein.

For patient B, the difference in the size of the protein may indicate a mutation or alteration in the gene responsible for encoding that protein, which could lead to a functional difference or potential health issue. Further testing and analysis would be needed to determine the specific implications for each patient.

Learn more about protein levels at: https://brainly.com/question/29520808

#SPJ1

If you infect the buffalo population with a disease , how do you predict that will affect the buffalo population ?

Answers

Rinderpest had been suppressing the populations, but once the vaccination program eliminated the disease in cattle, rinderpest also disappeared from Serengeti's wildlife. And that's when the buffalo and wildebeest boomed.

4. Which best describes a diagram of evolution? sc.7.L.15.2​

Answers

Answer:

The best description would be a bush.

Explanation:

Evolution resembled a tree, with a trunk branching off into different branches, which branch off into smaller branches, etc. This is basically the same as a bush. Any kind of line that's just a line, without any branching out, doesn't properly represent evolution because it only follows one line of evolution instead of accounting for the full picture.

Which scenario describes a relationship of commensalism

Answers

In an ecological interaction known as commensalism, one creature benefits while the other is neither aided nor hurt.

When a bird builds its nest in a tree, that is an example of a commensal relationship. The bird gains from having a secure location to erect its nest, while the tree receives neither assistance nor injury. The bird's nest has no impact on the tree's ability to grow and operate correctly.

In this relationship, the tree serves the bird's needs while the tree itself is unharmed. One creature gains, while the other is neither aided nor hurt, making this a commensalism example.

To learn more about commensalism:

https://brainly.in/question/8944221

How many grams of NaCl are needed to make 3L of a 10% solution?

Answers

To make a 10% solution of NaCl, we need to know the weight of NaCl required for 100 mL of solution. This can be calculated using the formula:

mass of solute (NaCl) = % concentration * volume of solution

Here, we have a 10% solution, which means that for 100 mL of the solution, we need 10 g of NaCl.

To find the amount required for 3 L of the solution, we need to convert 3 liters to milliliters. There are 1000 mL in 1 L, so 3 L = 3000 mL. Now, we can calculate the amount of NaCl required using the formula:

mass of NaCl = % concentration * volume of solution
= 10% * 3000 mL
= 0.10 * 3000 mL
= 300 g

Therefore, we need 300 grams of NaCl to make 3 L of a 10% solution.

what kind of spider is this, it's on a wild daffodil. I've named it Monica.​

Answers

Answer:

Long leg sac spider

Explanation:

Because it has long legs and the back looks like a sac hope this helps

The stamen, pistil and petals are a part of which living thing?

Answers

Answer:

A flower

Explanation:

List 5 establishments or firms related in hospitality business that uses the green supply management to cater to their costumer yet to achieve costumer satisfaction and name the items or supplies

Answers

Answer:

Explanation:

dxesrtgbm xzetfg

Answer:

Here are 5 establishments/firms related to the hospitality business that use green supply management:

1. Marriott International - This hotel chain has committed to sustainable sourcing for a variety of items, including seafood, coffee, and cotton.

2. Hilton Worldwide - Hilton is committed to sustainable sourcing of seafood, palm oil, and paper products, among others.

3. InterContinental Hotels Group - This hotel chain is committed to sustainable sourcing of seafood, coffee, and palm oil.

4. Starbucks - While not strictly a hospitality business, Starbucks is a major supplier of coffee to many hotels and restaurants. The company has committed to sustainable sourcing of coffee beans and paper products.

5. Whole Foods Market - This grocery chain supplies many hotels and restaurants with organic and sustainably sourced produce, meat, and other food items.

A plane is traveling 800 kph west. If the forces of lift, weight, thrust, and drag upon are in equilibrium for the whole time of the flight, what will the velocity of that plane be after three hours?

Answers

Answer is : 266.67

Explanation:
800kn=v • 3
V= 800km / 3
V= 266.67

Question 16 of 25
What is gene flow?
A. Two populations transferring genes
OB. When a population splits in two
OC. Selection for extreme traits
OD. A mutation becoming more common
SUMIT

Answers

A. Two populations transferring genes is gene flow

What alters two populations due to gene flow?

Gene flow has the effect of reducing genetic diversity among populations, inhibiting or delaying the development of populations in various geographic locations into distinct species of the disease.

The frequencies of alleles will fluctuate as a result of gene flow, the transfer of alleles caused by the movement of people or gametes across populations. Evolutionary change, which is frequent in natural populations, comes from deviation from any of these requirements.

Gene flow increases genetic variation when there is a continuum of alleles in the same way that a source of small-effect mutations would.

learn more about Gene flow

https://brainly.com/question/2698940

#SPJ1

What happens when matter changes in size or shape only?

A) A psychical change
B) A chemical change​

Answers

answer

A psychical change

A) physical change. This should be correct

The volume of Uranus is less than one-tenth of the volume of Saturn.
(the subject does not so the science I needed so I just put biology)

Answers

The volume of Uranus is less than one-tenth of the volume of Saturn. This assertion is accurate.

What are the distinctions between Saturn and Uranus?

Despite having a smaller mass, Uranus has a slightly larger diameter than its neighbor, Neptune. Saturn is the least dense planet, making it the second least dense after that. The methane gas in Uranus' atmosphere gives the planet its bluish-green hue. The cloud tops of Uranus reflect sunlight back out of the atmosphere as it passes through them.

How similar are Saturn and Uranus?

Similarities Between Saturn and Uranus: The atmospheres of both planets are primarily made of hydrogen and helium. Each planet revolves around the Sun. Both have a core that is hotter. They both have several moons.

To learn more about volume of planets visit:

brainly.com/question/16357823

#SPJ1

Question to answer: Do you feel that the Mcdonaldization of society is problematic or not? Explair
What to include:
At least 5-6 sentences
Your opinion
What should I write about

Answers

Answer:

The McDonaldization of society, a term coined by George Ritzer, refers to the homogenization and standardization of society, particularly in the realm of fast food and consumerism. In my opinion, the McDonaldization of society is problematic because it promotes a culture of conformity, where individuality and diversity are devalued. It also prioritizes efficiency and predictability over quality and uniqueness. The emphasis on speed and convenience has led to the proliferation of unhealthy and unsustainable food options, contributing to public health issues and environmental degradation. Moreover, the McDonaldization of society has resulted in the exploitation of low-wage workers and the concentration of wealth and power in the hands of a few large corporations. Overall, I believe that society should strive to promote diversity, creativity, and sustainability, rather than succumbing to the homogenizing forces of McDonaldization.

Explanation:

draw a symbol that depicts the lesson draw a symbol that depicts the lesson discussed explain it by creating an acrostic poem for the word "ADOLESCENCE"​

Answers

We can see here that explaining your lesson by creating an acrostic poem for the word "ADOLESCENCE," we have:

Astonishing, young minds evolving

Dreaming of brighter days in the future

Opposite of adulthood, this is a youth's chance

Learning from experiences that they may encounter

Every lesson teaches them an important trait

Seeking knowledge that will help their future traits

Cherishing each moment with close friends

Enlightening moments that will never end.

What is an acrostic poem?

An acrostic poem is a type of poem in which the first letters of each line are organized to spell out a word or phrase. In an acrostic poem, each line of the poem has a connection to the word or phrase that it spells out.

We can see here that this type of poem is often used as a creative writing exercise or for a special occasion.

Learn more about acrostic poem on https://brainly.com/question/26346712

#SPJ1

An investigator studies the amount of alcohol produced by yeast when it is incubated with different types of sugars.
What would be Control treatment:

Answers

The experiment's controls include the amount of alcohol present, the incubation environment, and the varieties of yeast utilized.

how alcohol affects the body?

Digestion issues, liver illness, high cholesterol levels, heart disease, and stroke. Cancer of the rectum, liver, colon, mouth, throat, esophagus, and breast. Immune system deterioration increases the likelihood of getting sick. issues with memory and learning, including dementia, and low academic achievement.

Alcohol – a healthy beverage?

Many short- & long-term health hazards, including as blood pressure problems, violent crime, risky sexual behavior, and different malignancies, are linked to alcohol usage. The likelihood of these negative effects grows as your alcohol consumption does.

To know more about Alchohol visit:

https://brainly.com/question/11908844

#SPJ1

Which pair of cities is moving apart as a result of plate motion

Answers

Answer:

.  London, Boston pair of cities is moving apart as a result of plate motion . London situated at the Eurasian plate and Boston in the North American plate

Explanation:

1. Index fossils are useful tools for geologists.
A. What information can index fossils tell geologists? (4 points)
B. What are three characteristics of a good index fossil? (6 points)

Answers

Answer:

A. Index fossils are useful tools for geologists because they can provide information about the relative age of rocks and help to correlate rock formations across different locations. By identifying and dating the age of index fossils found in a particular rock layer, geologists can determine the approximate age of the rock layer and its correlation with other rock layers in the region.

B. Three characteristics of a good index fossil are:

Widespread distribution: A good index fossil should have a wide geographic distribution, which means that it should be found in multiple locations around the world. This helps to establish a correlation between different rock layers that contain the same index fossil.

Limited time range: A good index fossil should have a limited time range, meaning that it should have existed for a relatively short period. This allows geologists to narrow down the age range of the rock layer containing the fossil.

Easily recognizable: A good index fossil should be easily recognizable, even in small or fragmented pieces. This allows geologists to quickly identify and date the fossil, even if only a small portion of it is present in the rock layer.

Overall, a good index fossil should be distinctive, easily recognizable, have a wide distribution, and a limited time range, all of which can provide useful information for geologists studying the history of the Earth.

Explanation:

Which part of the body contains bile an enzyme that helps down lipids

Answers

Answer:

liver

Explanation:

The liver produces bile, a solution that helps you digest fats. The gallbladder stores bile. As fatty food enters the upper portion of your small intestine (the duodenum), the gallbladder squeezes bile into the small intestine through the bile ducts.

Describe the events in excitation contraction coupling

Answers

Answer:

cardiac contraction-excitation The sequence of occurrences, from the generation of an electrical impulse to the contraction of cardiac muscles, is referred to as coupling. This procedure is essential because it enables the heart to beat in a regulated manner without requiring conscious effort. With the help of EC coupling, the cardiac muscles sequentially contract, allowing blood to be pumped between 60 and 100 times per minute, first to the lungs and subsequently the rest of the body.

Explanation:

PLS HELP I GIVE BRAINLIEST.

As you have learned in this lesson, arthropods are the largest phylum of animals. In this activity, you will need a notebook and a pencil or pen. You will investigate the natural surroundings of a place of your choice and search for critters in the arthropod phylum. Look under logs, rocks, in gardens, and other moist places. Each time you find one, if you know the name of it, write it down in a list. Otherwise, give it a name based upon its descriptive characteristics.

Place a tally mark next to an arthropod every time you find another of its kind, this way you can record how many of the same species you observe. Look in many different mini-habitats so you can find different types of arthropods.
Make careful observations about their body parts, the way they move, and how they respond when they notice your presence.

Answer the following questions:
Where did you find the most arthropods?
Which arthropod was most common in the areas you looked?
Which creatures did you find least often?

Answers

1. I found the most arthropods in a small forested area near a pond. There were so many different types of creatures to observe, it was incredible.
2. The most common arthropod I found was a type of beetle that had a shiny green carapace.
3. They were crawling all over the place! The creatures I found least often were a type of spider that was very small and hard to see. I only found a couple of them hiding under some leaves.

If I push on the ground with my foot with a force of 140 N Backwards, what will the force pushing my skateboard be?

Answers

The force pushing your skateboard will be equal in size and the opposite of the force your foot applies to the ground, assuming there is no friction between the skateboard and the ground.

Skateboard: What is Newton's third law?

Newton's first law states that unless another force acts on an item in motion, it will continue to move in the same direction and at the same pace. As long as no force is applied to a rolling skateboard, it will continue to move in the same direction and at the same pace.

What will happen if you're standing on the floor to the force of your body pressing down on it?

Every action has an opposite and equal response, according to Newton's third law. You may not realize it, but when you stand on the ground, you are exerting force against the ground since gravity is pulling you down due to your weight. The floor is pushing back in response.

to know more about skateboard here:

brainly.com/question/30286828

#SPJ1

can someone please help me, i dont know how to answer this. please give me pointers

Answers

Because, the passage itself describes about the nature of greenhouse effects. The greenhouse gases are absorbed by the soil. In order to protect the sensitive plants, we are going now for the modern greenhouse method i.e. artificial method. Transparent material which is nothing but like a sheet which covers the house is contructed to oppose the greenhouse gases to protect the plants. As the heat passes, some amount of heat won't escapes to atmosphere. This results in excess heat inside and leads the plants to die. Scientists say it's better to be the natural method of greenhouse effects.

1 2 3 a) Supply a suitable caption for this diagram b) Give labels of the parts numbered 1, 2, and 3. c) What process takes place in these structures? d) How are these structures mentioned in question 2(a), adapted to fulfill their functions? e) Where else in the body does the process take place?​

Answers

The caption for the diagram is the respiratory system

The parts labeled 1, 2, and 3 are:

bronchiolealveolialveolar sac

What are the adaptations of the bronchiole, alveoli, and alveolar sac to their functions?

The bronchioles, alveoli, and alveolar sacs are all structures within the respiratory system that are adapted to their specific functions:

Bronchioles: The bronchioles are small, branching tubes that lead from the larger bronchi to the alveoli. They have smooth muscle fibers that can contract or relax to adjust the airflow, ensuring that air is directed to where it is needed in the lungs.

Alveoli: The alveoli are small, thin-walled sacs at the end of the bronchioles where gas exchange takes place. They have a large surface area, which is achieved through the presence of many tiny air sacs. This maximizes the amount of gas exchange that can occur.

Alveolar sacs: The alveolar sacs are clusters of alveoli that are responsible for the majority of gas exchange in the lungs. They have a shape that allows them to accommodate a large volume of air, maximizing the amount of gas exchange that can occur.

Learn more about alveoli at: https://brainly.com/question/11720309

If having 8 repeats at loci 1 is found in 10 % of the US population, having 12 repeats at loci 2 is found in 5% of the US population, having 7 repeats at loci 3 is found in 10% of the US population, and having 5 repeats at loci 4 is found in 30% of the US population, if the US has a population of 300 million people, how many people in the US would have this DNA profile at those 4 loci?

Answers

This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci.

What is DNA?

DNA (Deoxyribonucleic acid) is a long, complex molecule that contains the genetic instructions used in the development and function of all known living organisms and many viruses. It is often described as the "blueprint" or "code" of life. DNA is composed of four types of nucleotides, which are the building blocks of the DNA molecule. Each nucleotide contains a sugar molecule, a phosphate group, and a nitrogenous base (adenine, thymine, guanine, or cytosine). The sequence of these bases along the DNA molecule determines the genetic information it carries.

Here,

To determine the number of individuals in the US population that have a specific DNA profile at these four loci, we need to multiply the percentage of individuals with each genotype at each loci. Let's start by finding the number of individuals in the US population who have 8 repeats at loci 1. We know that 10% of the US population has this genotype, so:

Number of individuals with 8 repeats at loci 1 = 10% of 300 million

= 0.1 x 300,000,000

= 30,000,000

Similarly, we can find the number of individuals with 12 repeats at loci 2:

Number of individuals with 12 repeats at loci 2 = 5% of 300 million

= 0.05 x 300,000,000

= 15,000,000

For loci 3:

Number of individuals with 7 repeats at loci 3 = 10% of 300 million

= 0.1 x 300,000,000

= 30,000,000

And finally, for loci 4:

Number of individuals with 5 repeats at loci 4 = 30% of 300 million

= 0.3 x 300,000,000

= 90,000,000

To find the number of individuals with all four of these genotypes, we need to multiply these four values:

Number of individuals with all four genotypes = 30,000,000 x 15,000,000 x 30,000,000 x 90,000,000

= 3.87 x 10²⁵

This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci. In practice, forensic DNA profiling typically looks at many more loci to increase the uniqueness of the DNA profile.

To know more about DNA,

https://brainly.com/question/30396067

#SPJ9

Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Answers

a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".

What is mRNA?

Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.

a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA",  first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.

b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.

c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.

To highlight exons, we can use three different colors. Let's use blue for  first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".

In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU

Highlighted with different colors for exons:

AUGAACCCGGGACGCGCGAUGCCCUAUU

^^^^ blue ^^ orange ^^^^ pink ^^^^

In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Highlighted with different colors for exons:

GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

^^^^ blue ^^ orange ^^^^ pink ^^^^

To know more about mRNA, refer

https://brainly.com/question/24885193

#SPJ1

Other Questions
BASED ON THE REDOX TITRATION EXPERIMENT, CAN SOMEONE HELP WITH THESE QUESTIONS? Which of the following is the same as 8(9+2)?8*9+88*9+28*9+8*29(8+2)2(8+9) which of the following statements are not true? check all that apply. Identify the underlined word as a participle, an infinitive, or a gerund. If the underlined word is not a verbal, select "Not a verbal. "To excite his young students, Mr. Perry used rap music to teach a unit on lyrical poetry. Factorise ax-a+x-1 By grouping terms in pairs In the United States , the 401(k) plan or individual retirement account is a defined ____ plan. How do I correctly simplify the expression and where did the student go wrong? Would it be unconstitutional for a court to apply the law chosenby the parties, if that law is wholly unrelated to the parties andtheir transaction? The offeror's act of withdrawing an offer is referred to as: a.repudiation. b. revocation. c. counteroffer. d. invitation tooffer. After spending 60 percent of his money , Joseph has a re 600. How much did he have in the beginning? find the area of the shaded region of the given circle PLS HELP!! Identify TWO geographic patterns indicated in the graph of the top automobile-producing countries in 2019.Graph showing the top motor vehicle producers in 2019; China 25,720,665, United States 10,880,019, Japan 9,684,298, Germany 4,661,328, India 4,516,017, Mexico 3,986,794, South Korea 3,950,617, Brazil 2,944,988, Spain 2,822,355, France 2,202,460, Thailand 2,013,710, and Canada 1,916,585. What was the purpose of Nixon's courting of China?a. To make sure the Chinese continued their support of North Vietnamb. To discourage the Chinese from supporting North Koreac. To ally the Chinese with another American ally, the Japanesed. To split the Chinese away from the Russians. Explain when/how exploration becomes exploitation Automobile Depreciation For a random sample of 20 automobile models, we record the value of the model as a new car and the value after the car has been purchased and driven 10 miles. 1 The difference between these two is a measure of the depreciation on the car just by driving it off the lot. Depreciation values from our sample of 20 automobile models can be found in the dataset CarDepreciation. Click here for the dataset associated with this question. Click here to access StatKey. Round your answers to the nearest integer. (a) Find the mean and standard deviation of the Depreciation amounts in CarDepreciation. Mean The demand on Samsung TVs at X-store for the past 3 years is given in this table in units/season: Year 1 Year 2 Year 3 Average indices ForecastSpring 1500 1650 1550Summer 1000 900 850Fall 500 600 550Winter 200 150 220The annual forecast for year 4 is 3710TVs. Use seasonality indexing to forecast the values of the 4th year (units/season), I will give brainliest to whoever answers this correctly, Answer is not x=0.1 1. Based on Source 1, which right had been denied to women in the 1800s? A. the right to equal pay in the workforce B. the right to attend religious ceremonies C. the right to freedom of speech D. the right to participate in electoral politicsBased on Source 1, which idea was most closely associated with the womens rights movement? A. the labor movement B. enumerated powers C. property rights D. inalienable rights3. Based on Source 2 and Source 4, which reform movement most likely shared similar goals with the womens rights movement? A. the labor movement B. the anti-immigration movement C. the secessionist movement D. the abolitionist movement4. Which statements best describe the womens rights movements during the 1800s? Select the two correct answers. A. It opposed the prohibition of the product and sale of alcohol. B. It had many members who supported other social-reform movements. C. It had strong support throughout the southern states. D. It wanted to discourage the teaching of Christianity. E. It had diverse membership that included men and women of different races. Need help on multiple choice question The following table represents measurement of the height of a bean sprout:Days after sprout was planted 7 9 11 13Height of sprout in inches 3 4.5 6 7.5Create a linear equation to represent this situation. According to your equation, how tall will the sprout be after 14 days?