Nucleotide are composed of a photosphate group a sugar and nitrogenous base DNA Isela made up of long Strands of nucleotide which part of the above molécule can differ between nucleotides

Answers

Answer 1

Answer:

The phosphate end and OH end of nucleotide in DNA differ from free nucleotides molecules.

Explanation:

5' phosphate group of one nucleotide and 3'-OH group of another nucleotide combine to form phosphodiester bond which holds the nucleotides in DNA molecule.

The phosphate end and OH end of nucleotide in DNA differ from free nucleotides molecules.


Related Questions

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Help me please, I’m confused

Answers

Answer:

Photosynthesis-

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities. Photosynthesis occurs in the chloroplast of a plant, which contains chlorophyll. In order for photosynthesis to take place, it needs to have water and carbon dioxide, the two very important raw materials necessary for this process. In the presence of carbon dioxide, such cells are able to convert this solar energy into energy-rich organic molecules, such as this energy-rich molecule known as glucose. Oxygen the by product of photosynthesis is inhaled by heterotrophs which aids in cellular respiration and other internal processes and then exhales carbon dioxide. ... In like manner, carbon dioxide passes from blood to the alveoli and exhaled after

Explanation:

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell

Answers

Answer:

c i think

Explanation:

I don't know just trying to help hope you have a good day

The answer is c a point mutation in the first chromosome of a sperm cell

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

which statement best describes the difference between the sympathetic and parasympathetic nervous systems?

Answers

Parasympathetic system calms you down lets all your organs have the same amount of oxygen delivered. The sympathetic system gets your muscles moving and makes you excited.

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

Other Questions
A fly hits a windshield of a truck. The truck exerts a force on the fly, andthe fly exerts an equal and opposite force back on the windshield.A. Newtons first law B. Newtons second law C. Newtons third law beslenmenin spor zerindeki etgisi Panuto: Kilalanin ang mga sumunod na pahayag king ito ay tumutukoy sa IMPERYOMG GHANA, IMPERYONG MALI, o IMPERYONG SONGHAI1. Matatagpuan ang sentro ng imperyong ito sa rehiyong tinatawag ba serdan.2. Unang estadong naitatag sa KanlurangAfrica.3. Tinatawag na "Lupain ng mga maitim".4. 700 daan taon naging makapangyarihan ang imperyong ito.5. Ang imperyong ito ay naging sentro ng kalakalan sa Kanlurang Africa.6. Tagapagmana ng Ghana.7. Kilala ang imperyong ito sa kanilang lakas at galing sa pakikidigma.8. Yumaman sa pamamagitan ng kalakalan.9. Imperyong pinalawak ni Haring Sunni Ali.10. Imperyong itinatag ni Sundiata Keita. Why did Thomas Jefferson oppose Hamiltons national bank?He thought it would be too weak.He thought it was unconstitutional.He wanted a more powerful government.He believed in the implied powers of the Constitution. List 9 World War 1 Events the length and breadth of a hall are 20m and 15m respectively. find the area of 4 Walls of the hall if the height of the hall is 10 m Define and write a sentence for each word.Expository essay Thesis statement Transition Persuasive essay Claim Paraphrase dar un ejemplo de cada una de estas lecturas:Lectura dominante, lectura negociada,lectura oposicinal What is the origin of Phillis Wheatley's name?A.The name of the ship that brought her from Africa, and the family name of her masterB.Her mother's favorite English poetC.Figures from classical Greek mythologyD.The name of the town in which she lived after she was given her freedom hi good morning i need help HELPPP PLEASEE literally pleaseeeee To create a model of an artery, a health teacher uses the scale 2.5 cm : 0.75 mm. If the diameter of the artery is 2.7 mm, what is the diameter on the model? a9 m b90 cm c18 cm d9 cm why do you feel flexibility is not practiced as often as aerobic or strength training? Why do people need to incorporate flexibility into their fitness routines? How can you incorporate flexibility into your routine? Which sentence contains an action verb? a. The old lady was amused. b. Those waffles are cold. c. My hamster is tired. d. Samantha and Stephanie arrived at the party late. What is the slope of the line through (-4,2) and (3, 3)? "/ yo Choose 1 answer: 19 21 42 142 A 7 5 B 7 5 5 7 5 7 e slope an please help! thanks! Trak Corporation incurred the following costs while manufacturing its bicycles. Bicycle components $100,000 Advertising expense $45,000 Depreciation on plant 60,000 Property taxes on plant 14,000 Property taxes on store 7,500 Delivery expense 21,000 Labor costs of assembly-line workers 110,000 Sales commissions 35,000 Factory supplies used 13,000 Salaries paid to sales clerks 50,000 Identify each of the above costs as direct materials, direct labor, manufacturing overhead, or period costs. Bicycle components select a classification Depreciation on plant select a classification Property taxes on store select a classification Labor costs of assembly-line workers select a classification Factory supplies used select a classification Advertising expense select a classification Property taxes on plant select a classification Delivery expense select a classification Sales commissions select a classification Salaries paid to sales clerks Answer the question provided in the picture below. workout the value of 2^0 In the late 1800s, where did most European immigrants live in the United States? on large farmsin large citiesjust outside citiesin small towns