plz help me plz plz thank you

Plz Help Me Plz Plz Thank You

Answers

Answer 1

Answer:

240

Step-by-step explanation:

bruh all you have to do is (11+5)*15


Related Questions

WILL GIVE BRAINLIST
options: given, vertical angles, corresponding angles, and transitive​

Answers

Answer:

1. Given

2. Vertical angles

3. Transitive

4. Corresponding Angles

Step-by-step explanation:

1. Number one is given because it is the statement that is given

2. Number two is vertical angles because they are two opposite angles that are formed by the same lines. The statement also says they are congruent, which is true of vertical angles.

3. From the given answers 3 must be transitive because <2=<4 and <2=<6. Although alternate interior angles is also an appropriate answer.

4. Number four must be corresponding because they are on the same side of the intersection of the lines, so they are both in the top right. Also, the statement says they are congruent which is true of corresponding angles.

If ∠1≅∠2, then ___...

a) ∠5≅∠6, angle 5 is congruent to angle 6

b) ∠3≅∠4, angle 3 is congruent to angle 4

c) XK≅YK

d )GK≅HK

e)All of the above are true

Answers

Answer: All of thé above

Step-by-step explanation:

can someone answer the problem, please?
158
× 4

Answers

158 x 4 = 632 :) shshdjdhdb

Answer:

the answer is 632

Step-by-step explanation:

just do some normal multiplication. :)  

Find the slope: (7,4) (5, 6)

Answers

Answer:

Slope =  - 1

Step-by-step explanation:

(x₁ , y₁) = (7,4)   & (x₂, y₂) = (5, 6)

Slope = [tex]\frac{y_{2}-y_{1}}{x_{2}-x_{1}}[/tex]

         [tex]= \frac{6-4}{5-7}\\\\= \frac{2}{-2}\\\\= - 1[/tex]

(p-5)/(p+1)=2/3 what does p =

Answers

Answer:

17

Step-by-step explanation:

Mrs. Brown asked four students how to find the perimeter of a rectangle where l = length and w = width. Their answers are below. Which would NOT find the perimeter of a rectangle?
A. P = l + w + l + w

B. P = 2 x l + 2 x w

C. P = 2(l + w)

D. P = 2(l x w)

Answers

Answer:

i think its B but i'm not 100 percent sure sorry if im not but i think i am

Step-by-step explanation:

Answer:

It's D

Step-by-step explanation:

You l*w is the area.

-28=-5x+7


Solve the two step equation

Answers

Answer:

x = 7

Step-by-step explanation:

-28=-5x+7

Add 28 and 5x to both sides

5x = 35

Divide both sides by 5

x = 7

Answer: x=7

Step-by-step explanation:

Let's solve your equation step-by-step.

−28=−5x+7

Step 1: Flip the equation.

−5x+7=−28

Step 2: Subtract 7 from both sides.

−5x+7−7=−28−7

−5x=−35

Step 3: Divide both sides by -5

-5x/-5 = -35/-5

x=7

Simplify the expression.
49^3/2

Answers

Answer:

i think its 58824.5

If you were to roll a die one time, what is the probability of it landing on an odd number

Answers

Answer:

It's one half.

Step-by-step explanation:

There are six sides on a dice, three of those sides (this is half) have negative numbers. Therefore the probability is 1/2 or 0.5 or a half.

Omg what kinds of questions are these do teachers really think we can tell if it’s gonna land on a odd number

Estimate a 15% tip on a dinner bill of $31.53 by first rounding the bill amount to the nearest ten dollars.

Answers

Answer:

Should be around 4.5

Step-by-step explanation:

If you round 31.53 to the nearest ten dollars, you get 30, 15 percent of 30 is 4.5

4.73 if it’s one person & if it’s for 2 people then 2.36 per person

#1- 2 is what percent of 16 #2- 15 is what percent of 80 #3- 38 is what percent of 200

Answers

Answer:

#1 .   12.5%

#2.   18.75%

#3.   19%

Step-by-step explanation:

2  / 16  x 100% = 12.5%

15 / 80  x 100% = 18.75

38 /200  x 100%= 19%

someone please help me. show your work for brainliest.

find the center and radius of the circle represented by the equation x^2 + y^2 - 4y - 8 = 0

Answers

Answer:

Attached file

Step-by-step explanation:

blank ÷ 3/7= 7/15. ​

Answers

Answer:

1 4/45

Step-by-step explanation:

Plz help this is worth 30 points

Answers

Answer:

Choice A

Step-by-step explanation:

You need 368cm of tape for a project, how many decimeters is this?

Answers

..............36.8 dm

368 cm of tape is equal to is 36.8 dm

Which expression is equivalent to -44
PLease asap 12 points please dont just take them

Answers

Answer:

|44|

Those are not Ones, those are the straight lines you can type using the Shift key and the key underneath the Backspace :)

Step-by-step explanation:

-44 is 44 places away from zero, and |44| is also 44 places away from zero. For those who are wondering, this symbol: | if is placed around a certain number, the positive or negative effect on that number is taken away, and the number is just thought as of that many spaces away from zero. EX: -9 => |9| is now not negative

Answer:

One equation is -22+-22

Solve the triangle. Round side lengths to the nearest tenth and angle measures to the nearest degree.​

Answers

Answer:

b = 13.8

A = 45°

C = 35°

Step-by-step explanation:

Given:

m<B = 100°

a = 10

c = 8

Required:

b, m<C, and m<A

✔️Find b using Cosine Rule:

b² = a² + c² - 2*ac*Cos(B)

Plug in the values

b² = 10² + 8² - 2*10*8*Cos(100)

b² = 164 - (-27.7837085)

b² = 191.783709

Take the square root of both sides

b = 13.8 (nearest tenth)

✔️Find m<C using Sine rule:

[tex] \frac{Sin(C)}{c} = \frac{Sin(B)}{b} [/tex]

Plug in the values

[tex] \frac{Sin(C)}{8} = \frac{Sin(100)}{13.8} [/tex]

Multiply both sides by 8

[tex] \frac{Sin(C)}{8} \times 8 = \frac{Sin(100)}{13.8} \times 8 [/tex]

[tex] Sin(C) = \frac{Sin(100) \times 8}{13.8} [/tex]

[tex] Sin(C) = 0.5709 [/tex]

[tex] C = Sin^{-1}(0.5709) [/tex]

[tex] C = 35 [/tex] (nearest degree)

m<C = 35°

✔️m<A = 180 - (100 + 35) (sum of triangle)

m<A = 180 - 135

m<A = 45°

120% of __________ is 78

Answers

120% of 65 is 78.

This means that 120 times what equals 78.

120*65=78

Answer:

65

Step-by-step explanation:

HOLA IM DORA AND IM GONNA NEED YOUR HELP FIGURING OUT THIS EQUATION?..... MUCHAS GRACIAS. what are the x-intercepts of the graph of y=x^2+5x+6?

A. (-2,0) and (-3,0)

B. (6,0) and (5,0)

C. (2,0) and (3,0)

D. (-6,0) and (-5,0)

Answers

Answer:

D

Step-by-step explanation:

yeah

A scuba diver starts at 85 3/4 meters below the surface of the water and descends until he reaches 103 1/5

meters below sea level. ​How many meters did he descend?


SHOW YOUR WORK

IF YOU SHOW WORK YOU GET EXTRA POINTS

MUST SHOW WORK

--------------------------------------------------
goodluck
xoxo

Answers

Answer/Step-by-step explanation:

If the Diver started at 85 3/4 below sea level (-85 3/4 from sea level.) And he descends more you have to find the difference between two distances.

In order to get to -103 1/5, how much was subtracted from the original distance of -85 3/4. To solve this use an inverse operation. Find the absolute value of the new distance and add the original distance from sea level.

I -103 1/5 I + -85 3/4 = 103 1/5 - 85 3/4 = 17.45.

The distance from each value is I 17.45 I So, the diver descended another 17.45 meters from sea level.

Can you measure 4 gallons of water using a 3 gallon jar and a 6 gallon jar?

Answers

Answer:

yes just fill up the 6 gallon jar up to the 4 galon mark

Step-by-step explanation:

Yes you can divide the 6 gallon jar in 6 levels. You can see how much water it is where witch level the water is

Which expression uses the associative property to make it easier to evaluate
8(1.3)

A. 8(3

B. 43

C. (8)

D. (8)

Answers

Answer:

The answer to this question is A. 8(3/5*1/4).

Answer:

b

Step-by-step explanation

i think

Help me please ! take your time and try your best thank you!

Answers

Answer:

C

Step-by-step explanation:

to find how much hours dan played the equation would be:

d = 2s - 4

to find the total:

s + d = 17

hope this helps :)

Answer: ABOVE

Explanation: This is what you did to countless others

What is the vertex of the graph of f(x) = |x – 13| + 11?

(–11, 13)
(–13, 11)
(11, 13)
(13, 11)

Answers

Answer:

(13, 11)

Step-by-step explanation:

I graphed the line and the vertex is at 13, 11

The vertex of the function  f(x) = |x - 13| + 11 is (13,11)

How to determine the vertex?

The function is given as:

f(x) = |x - 13| + 11

The above function is an absolute value function

An absolute value function is represented as:

f(x) = a|x – h| + k

Where, the vertex is (h,k)

So, we have:

(h,k) = (13,11)

Hence, the vertex of the function  f(x) = |x - 13| + 11 is (13,11)

Read more about vertex at:

brainly.com/question/24850937

#SPJ9

Please help!! answer choices and question below

Answers

Answer:

3 because 3 times 4 is 12 and 18 divided by 6 is 3

Step-by-step explanation:

Giving brainliest 10 points! Please help me with this question

Answers

Answer:

(0,-23)

Step-by-step explanation:

Are the two given triangles similar? Show your work to support your answer.
Helpppp please

Answers

Answer:

no

Step-by-step explanation:

1 is obtuse one is acute

Please help!!!! Due soon!!
I’ll mark you the brainliest answer! Please

Answers

Answer:

3/2 or 1.5

Step-by-step explanation:

Answer:

Step-by-step explanation:

X+2

F(x) +3

Is the relation shown in the arrow diagram a function? Justify your answer.

Alternative text


Yes. The input 0.8 and 0.4 have only one output.


Yes. Each output has only one input.


No. Each input has only one output.


No. The input 1.2 has 2 outputs.

Answers

Answer:

No. The input 1.2 has 2 outputs.

Step-by-step explanation:

See attachment for complete question

The first circle represents the domain while the second represents the range of the function.

For a mapping to be a function, it must either be a one to one relationship or a many to one relationship.

One to one, in the sense that; there can be only one entry in the domain points to one entry in the range of the function.

Many to one, in the sense that: there can be multiple domain entries that point to one entry in the range of the function

However, from the attachment it can be seen that an entry in the domain (1.2) points to two entries in the range (6 and 8).

Hence, this does not represent a function.

a) Estimate the value of 50.75 x 0.18

Answers

Answer:9.135

Step-by-step explanation: I had have this answer

Answer:

9.135

Step-by-step explanation:

Other Questions
help meWhat are the best exercises that will help increase my target heart rate to at least 60% or above? As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz Connections Academy Geometry10A semester exam. Does anyone have the answers im 1% away from passing. d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs.