Answer:"Process of breaking down glucose to obtain energy in the form of ATP" also known as Cellular Respiration.
I hope this helps
Explanation:
In your own words explain why the sky is blueI
Answer:
As white light passes through our atmosphere, tiny air molecules cause it to 'scatter'. The scattering caused by these tiny air molecules (known as Rayleigh scattering) increases as the wavelength of light decreases. ... Therefore, blue light is scattered more than red light and the sky appears blue during the day.
Explanation:
Thank You I hope it's helpfull...
5. What does the pH scale measure and why is this important?
water vapor present in air support water cycle
In cocker spaniels, solid color (S) is dominant over spotted (s). If a solid male is crossed with a spotted female and they produce all solid colored puppies, the genotypes of the parents must be:
Answer: the genotypes must be solid that is. if the male is a solid colored genotype
Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Answer:
CCGATAGGT
Explanation:
got this for my hw.
Answer:
So the central dogma of molecular biology describes the journey from DNA to protein product:
DNA --transcription--> mRNA --translation--> Protein
Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).
In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.
5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’
We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:
mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.
Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.
To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.
5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu
Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.
In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.
Explanation:
n
Pls, help with science (:
what can i help u ask me if i can i will say you
WILL GIVE BRAINLEST Why do plants store some of the food they produce?
A. to live through periods when they already have too much food
B.to have tough structures for defense
C.to provide food for other plants
D.to survive periods when they cannot make enough food
Answer:
D is your answer
Explanation:
there are times when plats cant photosynthesis to make food. So they rely on their food storage so they don't die.
Steroids are a type of what?
lipids
carbs
sugar
hormone
Answer:
lipids
Explanation:
Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight
Bone —> provides structure for the body.
Heart —> pumps blood through the body.
Stomach —> breaks down food into small particles.
Lung —> oxygenates blood.
How can i earn money from this app?
Answer:
u dont earn money from brainly. the point is altruistic help
Explanation:
if u mean something else, provide context and ill leave a comment with the correct answer
reproduction is not necessary for the continuation of species
Answer:
It is necessary.
Explanation:
If a member of a species doesn't reproduce, other members of the same species will become extinct.
4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next
Answer:
condensation, precipitation, infiltration, runoff, and evapotranspiration.
condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.
what is condensation ?It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.
It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.
The boiling point and the condensation point are same and take place at 100 degrees Celsius.
The temperature range of condensation occurs between 0 degree Celsius to 100 degree Celsius.
In water cycle due to condensation water molecule forms a cumulous clouds and fog followed by fall down of water droplets on the Earth’s surface as precipitation, which is commonly called rain.
Rain water enters the earth’s waterways, soil absorbed by plants or freeze into its solid form ice form.
Learn more about water cycle, here:
https://brainly.com/question/9243222
#SPJ5
The biome immediately south of the Taiga is the ______.
(A) Temperate deciduous forest,
(B) Savanna
(C) Tundra
(D) Chaparral.
Answer:
tundra
Explanation:
Pandas eat bamboo for energy. What are pandas classified as
Answer:
Pandas are classified as herbivores despite their taxonomic classification as a carnivore.
What is the most valid conclusion regarding ocean depth temperature, based on the data? The temperature and salinity increase with increasing depth. The salinity increases as the depth goes closer to zero. The bottom of the ocean is frozen and salinity levels are low. The ocean temperature never rises above 10°C and salinity remains constant.
The most valid conclusion concerning ocean depth temperature is B. The salinity increases as the depth go closer to zero.
Effect of Salinity on Water Depth
Decreasing ocean temperature increases ocean salinity. These occurrences put pressure on water as the water depth increases with decreasing temperature and increased salinity.
What is Ocean Salinity?
Ocean Salinity refers to the saltiness or amount of salt dissolved in a body of water. The salt dissolution comes from runoff from land rocks and openings in the seafloor, caused by the slightly acidic nature of rainwater.
Thus, the most valid conclusion one can draw regarding ocean depth temperature is Option B.
Learn more about ocean depth temperature and ocean salinity here: https://brainly.com/question/1512203 and https://brainly.com/question/10335431
65 points, anwser asap, graph below
What is happening to the deer population between the years 2005 to 2010? Support with reasoning from our model of population growth.
Answer:wolves
Explanation:
wolves decreased the population because they kept increasing so people killed the and a couple of years later they went up the so they brought wolves back!
All sugars are considered:
a carb
a fat
just sugars
a lipid
Answer: fat......................................
One important function of bones is to produce ……………….
Answer:
Red blooded cell, White blooded cell and platelets
PLEASE HELP ME ANSWER THIS!!!!!
Outline a heart-healthy “plan” for a person’s whole life: in other words, provide at least two pieces of advice appropriate for a person interested in heart health across their lifespan. Discuss advice appropriate for newborns or very small children; young adults between 18 and 24 years of age; someone in their 40s; and someone over 65. Provide at least one piece of age-appropriate advice specific to the interests, activities, and general health of an average person in each age group.
A heart-healthy plan for everyone is to eat lots of fruits and vegetables. It's also important to eat low-fat dairy products.
The heart is a vital organ in the body as it keeps the circulation of blood. For children, they should be served fruits and vegetables everyday. They should also eat whole grains.
For adults, they should eat more fish and less red meat. They should also eat lots of fruits and vegetables. Nuts, beans, legumes, and low-fat dairy products are also important for the heart.
Learn more about the heart on:
https://brainly.com/question/75085
the empirical (scientific) method of study is based on ______
Answer:
Empirical research is based on observed and measured phenomena and derives knowledge from actual experience rather than from theory or belief.
Key characteristics of empirical research:
- Specific research questions to be answered
- Definition of the population, behavior, or phenomena being studied
- Description of the process used to study this population or phenomena, including selection criteria, controls, and testing instruments (such as surveys).
Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help
NEED ANSWER! WILL BRAINLIST!
•During the mining process, which step immediately follows separating the mineral from the waste rock?
A. refining
B. distribution
C. crushing and milling
D. drilling and blasting
Answer:
C
Explanation:
What is Ecological Sustainability? What happens if we use all of our planet's resources without replacing them?
Answer:
Ecologically sustainable development is the environmental component of sustainable development. It can be achieved partially through the use of the precautionary principle. The precautionary principle (or precautionary approach) is a broad epistemological, philosophical and legal approach to innovations with potential for causing harm when extensive scientific knowledge on the matter is lacking. It emphasizes caution, pausing and review before leaping into new innovations that may prove disastrous
Explanation:
The triplet code of bases for RNA may be represented by all of the following except -
F CGT
G CGA
H CGG
O CGU
what's photosynthesis are
Answer:
Production of sucrose in plants from light energy
Explanation:
PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.
Answer:
2-4 months for carrots and about 120 days for corn
Explanation:
6. All of the following are renewable resources except for:
A. fossil fuels
B. soil
C. water
D. forests
a - fossil fuels
step by step explanation:
fossil fuels are non-renewable and will run out
why are the offspring of coral identical to the parent
they reproduce sexually so offspring have increased genetic variation
they reproduce asexually so offspring have increased genetic variation
they reproduce sexually so offspring have decreased genetic variation
they reproduce asexually so offspring have decreased genetic variation
Answer:
they reproduce asexually so offspring have decreased genetic variation
Explanation:
when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!
Which of these describes the complexity of abiotic and biotic factors within an ecosystem that supports a specific species?
A.fauna
B.biome
C.climate
D.habitat
In an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.
What is an Habitat?An habitat can be described as the sum total of resources, abiotic and biotic factors that are found in a particular environmental area which support the survival and growth of a specific species that is better adapted to it.
Examples of HabitatsWoodland Forest SeashoreGrasslandTherefore, in an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.
Learn more about habitat on:
https://brainly.com/question/931161
Which is a type of mining that is very dangerous but doesn't disrupt much of the surface? A Surface mining B. Strip mining C. Mountaintop removal D. Long wall mining
Answer:
Surface mining.
Explanation:
Surface mining can severely erode the soil or reduce its fertility. It can also pollute waters or drain underground water reserves; scar or altar the landscape; damage roads, homes, and other structures; and destroy wildlife.