T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

Answer 1

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer 2

Answer:

C

Explanation:


Related Questions

If a person with Klinefelter’s syndrome wanted to look more like an average male, what medical treatment could help accomplish this?

Answers

A testosterone replacement

Which of these organisms are herbivores?
producer
primary consumer
decomposer
scavenger

Answers

It should be “primary consumer”,

because everything else eats the primary consumer which eats the producer

Guys, can you please be so generous to help me out

Answers

Answer:

Here you go. Sorry for taking so long.

Explanation:

The graph shows the change in seabird mortality rates in New Zealand waters due to illegal, unreported, and unregulated fishing (IUU) and the implementation of bycatch remediation measures in 2004. What conclusion can be made about the impact of the remediation measures that were used?

Illegal and unregulated fishing practices continue to cause increases in bird bycatch numbers, in spite of the new measures.
Legal fishing practices have caused the new remediation measures to become more effective.
The measures virtually eliminated all of the bird bycatch.
The measures used showed very little impact on the overall seabirds caught in fishing lines.

Answers

According to the graph, the measurements practically eliminated all incidental captures, as shown in the third answer option.

What does the graph show?Illegal capture practices show a high performance between 1997 and 2003.Illegal capture practices show a low performance from 2004 and this performance tends to fall in the next years until it presents very low values.Legal capture practices maintain a balanced performance.

The decrease in the performance of illegal practices from 2004 onwards, shows how the remediation measures were efficient in reducing the activity of these practices and providing a better environmental well-being.

More info about graphics on the link:

https://brainly.com/question/14323743

Climates are classified on_________​

Answers

Climates are classified on seasonal precipitation and temperature patterns.

Engineering and work practice controls have evolved primarily

Answers

Engineering and work practice controls have evolved primarily: To teach the hierarchy and application of preventive strategies To enforce compliance by housekeeping and maintenance departments To comply with federal law For control of exposure to bloodborne and airborne pathogens. [tex][/tex]

Engineering and work practice controls have evolved primarily D. For control of exposure to bloodborne and airborne pathogens.

What are engineering and work practice controls?

Engineering and work practice controls are the workplace controls that:

Eliminate or isolate biohazards.Promote safer workplace behaviors.Enforce handwashing procedures.Restrict eating and drinking in work areas.Decontaminate equipment before servicing.Reduce the likelihood of exposure to workplace incidents.

A pathogen is a disease-causing organism that may invade the body cells, including viruses, bacteria, fungi, protozoa, and worms.

Answer Options:

A. To teach the hierarchy and application of preventive strategies.

B. To enforce compliance by housekeeping and maintenance departments.

C. To comply with federal law.

D. For control of exposure to bloodborne and airborne pathogens.

Thus, Engineering and work practice controls have evolved primarily D. For control of exposure to bloodborne and airborne pathogens.

Learn more about Engineering and Work Practice Controls at https://brainly.com/question/17034763

What happens to sunlight photons?

Answers

Answer:

All of the infrared photons are absorbed and re-radiated by the glass pane.

Sunlight photons interact with the Earth's atmosphere, scattering, absorbing, and transmitting, influencing weather, photosynthesis, and regulating the planet's temperature.

When sunlight photons reach the Earth's atmosphere, several interactions occur. First, a fraction of photons is absorbed by atmospheric gases, which excite their molecules. Some photons are scattered in various directions due to Rayleigh or Mie scattering, making the sky appear blue and contributing to diffuse light. Next, photons that pass through the atmosphere may interact with clouds, dust, and aerosols, leading to further scattering and absorption.

Eventually, the remaining photons reach the Earth's surface and may be absorbed, reflected, or transmitted. The absorbed photons can warm the Earth, driving weather patterns and supporting photosynthesis in plants. Reflecting and transmitting photons play a crucial role in regulating Earth's temperature and energy balance.

To learn more about photons follow the link:

https://brainly.com/question/14839718

#SPJ2

The complete question is:

What happens to sunlight photons when they reach the Earth's atmosphere?

why is it beneficial for scientists to understand how other organisms are able to edit which proteins are created

Answers

Answer:

Genome editing technologies enable scientists to make changes to DNA, leading to changes in physical traits, like eye color, and disease risk

Explanation:

what is The basic unit of biological classification

Answers

Explanation:

The basic unit of biological classification is Species

the peripheral nervous system is involved in
A. voluntary but not involuntary, actions
B. both voluntary and involuntary actions
C. involuntary but not voluntary actions​

Answers

Answer:

B. Both voluntary and involuntary actions

Answer:

b both voluntary and involuntary actions

Explanation:

peripheral nervous system is the whole system which is composed of voluntary actions ( by purpose actions eg. running) and involuntary actions ( natural actions eg. heartbeat)

Which type of fish are sharks?
A. deep sea fish
B. cartilaginous fish
C. lampreys
D. bony fish
Please help!!

Answers

Answer:

B. Cartilaginous fish

Explanation:

Sharks have a cartilaginous skeleton. Cartilage is less dense than bone which allows sharks to move quickly through the water without using too much energy.

Which of the following are true about the peripheral nervous system?
O A. Contains all the neural structures outside the brain and spinal cord.
B. It is divided into the somatic and autonomic nervous systems.
O C. It controls voluntary movements
O D. Includes the brain stem and the cerebellum
E. Dorsal and ventral horns fuse laterally to form spinal nerves.
OF. It's white matter includes the ventral, dorsal, and lateral white columns
O G. It's gray matter includes: gray commissure, dorsal horn, ventral horn, and lateral horn.
o H. It contains cranial and spinal nerves, ganglia, sensory receptors, and efferent motor endings

Answers

Answer:

pick one

Explanation:

big deal if you have it wrong

Which of the following is an example of bioremediation?
a .using microorganisms to clean up an oil spill
b. using bacteria to make yogurt.
c. creating plants that are resistant to bacteria.
d. adding nitrogen-fixing bacteria to the soil before planting crops

Answers

Answer:

A: Using microorganisms to clean up an oil spill.

Explanation:

Bioremediation is a subcategory under biotechnology which alters environmental conditions with the usage of living organisms. It's a process that focuses on breaking down contaminants - making it an effective method to clean up oil spills due to its efficiency and affordability compared to other options.


The diagram below represents one way an enzyme can be inhibited (stopped).

Which statement explains the effect of an inhibitor on an enzyme?
The substrate will not be able to attach to the enzyme's active site.
O The enzyme will likely be attacked by immune cells.

Answers

Answer:

The answer is The substrate will not be able to attach to the enzyme's active site.

Because the function of inhibitors is to block the enzyme's activity

Explanation:

PLEASE MARK ME BRAINLIEST IF MY ANSWER IS CORRECT

The substrate will not be able to attach to the enzyme's active site. So the correct option is A.

What is an enzyme inhibitor?

The inhibition is carried out by inhibitors that do not advance the product's development. The inhibitors may affect the enzyme as well as the substrate. Enzyme inhibition is the term used to describe the cessation of enzyme activity.

These enzyme inhibitors can bind to active regions and prevent further action by stopping it. Both reversible and irreversible forms of binding are possible. The ability of an inhibitor to block an enzyme may be irreversible or reversible depending on its unique function. Enzyme inhibitors can block the binding site, which reduces the enzyme's catalytic activity by preventing the substrate from binding to the active site.

Reversible inhibitors bind to enzymes by non-covalent interactions such as ionic bonds, hydrogen bonds, and hydrophobic contacts. Reversible inhibitors do not conduct chemical reactions when they are linked to an enzyme and are quickly removed by dilution or dialysis.

However, irreversible inhibitors usually covalently change an enzyme, making it impossible to reverse inhibition.

Therefore, the correct option is A.

Read more about enzyme inhibitors, here

https://brainly.com/question/17320375

#SPJ2


Post-translational modifications of proteins may include which of the following processes?

Answers

Post-translational modifications of proteins makes them functional and include:

methylationaddition of disulphide bridges folding phosphorylation

What is post-translational modification of proteins?

Post-translational modifications of proteins refers to modifications that are made on new synthesized proteins after synthesis at the ribosomes.

Post-translational modifications of proteins are important as they help to convert the proteins into their active forms.

Some post-translational modifications of proteins include:

methylationaddition of disulphide bridges folding phosphorylation

Therefore, post-translational modifications of proteins are required to make proteins functional.

Learn more about proteins at:https: //brainly.com/question/884935

What that determines if a cell is eukaryotic. *

Answers

To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
there’s not any answer choices, but eukaryotic cells possess a clearly defined nucleus. they also have more organelles

Which of the following animals are examples of vertebrates? 
a. elephants, snakes, sea sponge, earthworms b. humans, hawks, sun fish, bullfrogs
c. humans, ants, spiders, bullfrogs
d. butterflies, clams, earthworms, jellyfish ​

Answers

Answer:

B: humans, hawks, sunfish, bullfrogs

Explanation:

B. Humans, hawks, sun fish, bullfrogs

describe how energy is transferred through a food chain


PLSS ANSWER IM BEGGING YOU

Answers

Well energy is transferred between organisms in food webs from producers to consumers. The energy is used by organisms to carry out complex tasks. The vast majority of energy that exists in food webs originates from the sun and is converted (transformed) into chemical energy by the process of photosynthesis in plants.on:

Answer:

Energy is passed between organisms through the food chain. Food chains start with producers. They are eaten by primary consumers which are in turn eaten by secondary consumers. They are then eaten by tertiary consumers and in a long food day these can be eaten by quaternary consumers.

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

PLEASE HELP 10 POINTS!

Why is humus an effective fertilizer? (Select all that apply.)

It is abundant in inorganic nutrients.
It is dense and does not contain organic matter.
It is rich in organic matter.
It doesn’t need microorganisms to decompose matter

Answers

Answer:

It is rich in organic matter.

Explanation:

Humus is organic material formed when an animal or plant decays.Humus is formed by the decomposing action of soil microorganisms.

Define nondisjunction. Is this a beneficial process? Explain.

Answers

Answer:

Nondisjunction occurs when chromosomes fail to segregate during meiosis; when this happens, gametes with an abnormal number of chromosomes are produced. The clinical significance is high: nondisjunction is the leading cause of pregnancy loss and birth defects

Explanation:

7. What do sea spiders use for gas exchange?

Answers

Answer:

sea spiders are marine arthropods that lack gills and rely on cutaneous respiration but still grow to large sizes. Their cuticle contains pores, which may play a role in gas exchange

HELP ME OUT PLS!!!!!!!!

7) If there is a third-quarter moon on July 2, what is the approximate date of the next full moon?

A) July 9th

B) July 16th

C) July 23rd

D) July 30th​

Answers

Answer:

A -- July 9th

Explanation:

I say July 9th because A full Moon happens roughly every 29.5 days. This is the length of time it takes for the Moon to go through one whole lunar phase cycle.

Hope this helps! Please let me know if you need more help or think my answer is incorrect. Brainliest would be MUCH appreciated. Have a wonderful day!

What material is the objective lens made of in UV fluorescence microscopy

Answers

Answer:

quartz

Explanation:

Which is a no renewable source of energy?

Answers

Answer:

C) natural gas

Explanation:

Wind, water, and sunlight are abundant and easily renewable for energy. Natural gas is the only option that becomes more scarce as it is extracted from the earth.

Which of these is NOT one of the 4 chemicals used in DNA?

A. Adrenaline

B. Cytosine

C. Thymine

D. Adenine

Answers

Answer:

A. Adrenaline

Explanation:

adrenaline is a hormone

Answer:

A. Adrenaline

Explanation:

A is NOT correct because the actual 4 chemicals in DNA are Adenine,Cytosine, Thymine and Guanine.

Adrenaline is NOT part of the 4 chemicals of the DNA, which makes A correct answer.

ABO blood group determination is a example of

Answers

ABO blood group determination is a example of multiple Alleles.

What is Multiple Alleles?

Multiple alleles refer to a type of non-Mendelian inheritance pattern that comprises of more than the normal two typical alleles that is dorminant and recessive alleles that usually code for a certain characteristic in a species.

Examples of multiple Alleles is the genes of ABO blood group determination.

Therefore, ABO blood group determination is a example of multiple Alleles.

Learn more about multiple alleles here.

https://brainly.com/question/8738101

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

Is the highlighted group a class or a clade?

A.
It is a clade, because not all of the descendants of the ancestral species are included.
B.
It is a class, because not all of the descendants of the ancestral species are included.
C.
It is a clade, because the cladogram does not show that the group is descended from a common ancestor.
D.
It is a class, because the cladogram does not show that the group is descended from a common ancestor.

Answers

Although we do not have access to the diagram to provide a complete answer, we can confirm that a clade is when all members of the group being highlighted belong to a common ancestor.

What is a clade?

As stated, this is when the members of a depicted group belong to the same ancestor. It would be a clade if the organisms present are all descendants of a common ancestor, such as the class Aves or birds.

Therefore, we can confirm that a clade is when all members of the group being highlighted belong to a common ancestor.

To learn more about taxonomy visit:

https://brainly.com/question/715807?referrer=searchResults

Which animal phylum was the first to develop a dorsal nerve cord a backbone?

Answers

Answer:

Chordates?

Explanation:

Other Questions
1. You've probably heard the statement, "You can't believe everything you read in newspapers or see on TV."What does that statement mean to you? A cat weighs8 1/4pounds.How many ounces does the cat weigh? The two graphs shown represent the motion of two blocks with different masses, m1 and m2. The blocks are oscillating on identical springs. Which of the following statements correctly describes the relationship between m1 and m2 and provides evidence from the graphs? help please i guess? a rectangular garden is 1.25 meters wide and 3.4 meters long. what is the area of the garden? What is -4x^2-6x-4 in vertex form? Please help ASAP Identify the logical association The triangle is not necessarily drawn to scale, and the angles can vary. Create a compound inequality for the side length x using the Triangle Inequality.A. 2 < x < 12B. 5 < x < 7C. 5 < x < 12D. 2 < x < 7 A right triangle has a leg of 17 cm and a hypotenuse of 25 cm. What is the length of the other leg? Round to the nearest tenth. 11/which of the following is true?A. Warmer colors advanced; cooler colors recede.B. Lighter colors advanced ; darker colors recede.C. Purer colors recede ; duller colors advance.D. Duller colors advance; Warmer colors recede. Describe the different internal and external factors that affect human health. what must dna copy one at a time in the process of dna replication In healthcare settings where sterilization is an absolute necessity, what method of sterilization will typically be used?pasteurizingdisinfectingautoclavingboilinglyophilizing HELP ASAP!!! ILL GIVE LOTS OF POINTS AND BRAINLISTPLEASE SHOW HOW YOU GOT THE ANSWER! According to the World Health Organization, almost ___________ of all diseases are caused by environmental exposure. 9 is what percent of 90? Look at the tropical grassland ecosystem.Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.There are more zebra than the carrying capacity of the pictured ecosystem. This represents a climax community biological surplus peak phenomenon sigmoid phenomenon Name the five carbon sugar in a DNA neucleotide Name any four source of carbon The side of a goal in soccer is the shape of a right trapezoid. The dimensions are shown below. What is the area of the net needed for both sides of the goal? ft 8 ft 10 ft