The parallel plates in a capacitor, with a plate area of 8.00 cm2 and an air-filled separation of 2.70 mm, are charged by a 8.70 V battery. They are then disconnected from the battery and pulled apart (without discharge) to a separation of 6.80 mm. Neglecting fringing, find (a) the potential difference between the plates, (b) the initial stored energy, (c) the final stored energy, and (d) the work required to separate the plates.

Answers

Answer 1

Answer:

a)  ΔV₁ = 21.9 V, b) U₀ = 99.2 10⁻¹² J, c) U_f = 249.9 10⁻¹² J,  d)  W = 150 10⁻¹² J

Explanation:

Let's find the capacitance of the capacitor

         C = [tex]\epsilon_o \frac{A}{d}[/tex]

         C = 8.85 10⁻¹² (8.00 10⁻⁴) /2.70 10⁻³

         C = 2.62 10⁻¹² F

for the initial data let's look for the accumulated charge on the plates

          C = [tex]\frac{Q}{\Delta V}[/tex]

          Q₀ = C ΔV

           Q₀ = 2.62 10⁻¹² 8.70

           Q₀ = 22.8 10⁻¹² C

a) we look for the capacity for the new distance

          C₁ = 8.85 10⁻¹² (8.00 10⁻⁴) /6⁴.80 10⁻³

          C₁ = 1.04 10⁻¹² F

       

          C₁ = Q₀ / ΔV₁

          ΔV₁ = Q₀ / C₁

          ΔV₁ = 22.8 10⁻¹² /1.04 10⁻¹²

          ΔV₁ = 21.9 V

b) initial stored energy

          U₀ = [tex]\frac{Q_o}{ 2C}[/tex]

          U₀ = (22.8 10⁻¹²)²/(2  2.62 10⁻¹²)

          U₀ = 99.2 10⁻¹² J

c) final stored energy

          U_f = (22.8 10⁻¹²) ² /(2  1.04 10⁻⁻¹²)

          U_f = 249.9 10⁻¹² J

d) the work of separating the plates

as energy is conserved work must be equal to energy change

          W = U_f - U₀

          W = (249.2 - 99.2) 10⁻¹²

          W = 150 10⁻¹² J

note that as the energy increases the work must be supplied to the system


Related Questions

Which statement correctly describes the relationship between air temperature and air pressure?

-Warm air rises, creating an area of low pressure.

-Cool air sinks, creating an area of low pressure.

-Warm air sinks, creating an area of low pressure.

-Cool air rises, creating an area of low pressure.

Answers

warm air rises, creating an area of low pressure

A new piece of exercise equipment has been added to your gym, and you try it out. To use this machine, you lie horizontal on a mat with your feet against a platform perpendicular to the mat. The platform is held by a stiff spring that is compressed when the platform moves. Your workout invovles compressing the spring by pushing on the platform with your feet. After testing compressions of the equipment, you determine that you must do 85.0 J of work to compress the spring a distance 0.170 m from its uncompressed length.What magnitude of force must you apply to hold the platform stationary at the final distance given above

Answers

Answer:

500 N

Explanation:

Since the work done on the spring W = Fx where F = force applied and x = compression length = 0.170 m (since the spring will be compressed its full length when the force is applied)

Since W = 85.0 J and we need to find F,

F = W/x

= 85.0 J/0.170 m

= 500 N

So, the  magnitude of force must you apply to hold the platform stationary at the final distance given above is 500 N.

Una varilla efectúa 120 vibraciones durante un minuto. Hallar el período y la frecuencia del movimiento

Answers

yeah that’s why you didn’t want me to do that it would like be a little more than what you would do for you guys i and orange green brown brown orange brown brown green orange green brown green green brown brown orange brown brown green brown orange brown brown white brown green brown orange

A disk 7.90 cm in radius rotates at a constant rate of 1 190 rev/min about its central axis. (a) Determine its angular speed. 124.58 Correct: Your answer is correct. rad/s (b) Determine the tangential speed at a point 2.98 cm from its center. 3.71 Correct: Your answer is correct. m/s (c) Determine the radial acceleration of a point on the rim. magnitude 1.23 Correct: Your answer is correct. km/s2 direction toward the center Correct: Your answer is correct. (d) Determine the total distance a point on the rim moves in 2.06 s. 20.28 Correct: Your answer is correct. m

Answers

Answer:

[tex]124.62\ \text{rad/s}[/tex]

[tex]3.71\ \text{m/s}[/tex]

[tex]1.23\ \text{km/s}^2[/tex]

[tex]20.28\ \text{m}[/tex]

Explanation:

r = Radius of disk = 7.9 cm

N = Number of revolution per minute = 1190 rev/minute

Angular speed is given by

[tex]\omega=N\dfrac{2\pi}{60}\\\Rightarrow \omega=1190\times \dfrac{2\pi}{60}\\\Rightarrow \omega=124.62\ \text{rad/s}[/tex]

The angular speed is [tex]124.62\ \text{rad/s}[/tex]

r = 2.98 cm

Tangential speed is given by

[tex]v=r\omega\\\Rightarrow v=2.98\times 10^{-2}\times 124.62\\\Rightarrow v=3.71\ \text{m/s}[/tex]

Tangential speed at the required point is [tex]3.71\ \text{m/s}[/tex]

Radial acceleration is given by

[tex]a=\omega^2r\\\Rightarrow a=124.62^2\times 7.9\times 10^{-2}\\\Rightarrow a=1226.88\approx 1.23\ \text{km/s}^2[/tex]

The radial acceleration is [tex]1.23\ \text{km/s}^2[/tex].

t = Time = 2.06 s

Distance traveled is given by

[tex]d=vt\\\Rightarrow d=\omega rt\\\Rightarrow d=124.62\times 7.9\times 10^{-2}\times 2.06\\\Rightarrow d=20.28\ \text{m}[/tex]

The total distance a point on the rim moves in the required time is [tex]20.28\ \text{m}[/tex].

Predict what will happen if the 30 kg child was closer to the pivot (more right) and explain your reasoning

Answers

More to the right of what

How do mountains affect the climate of a region?

Answers

in some areas, mountains block rain, so one side may be rainy while the other is dry. the mountains create a barrier for wind as well, so the climate on one side can be warm, and cold on the other

PLEASE HELP QUICKLY!!!
what happens to the motion of objects when they hit each other?

Answers

Answer:

When two objects in motion hit each other they experience forces that are equal in magnitude and opposite in direction. This force causes one of the objects to speed up or gain momentum and other to slow down or lose momentum.


6. Calculate the pressure exerted on an elevator floor which has an
area of 6 m², if 20 people whose combined force is 1500 N are
standing on it.

Answers

Answer:

Hope this helps you out if you could please leave 5 stars or brainiest thank you

Jackie rides her bike to school every day and enjoys playing beach volleyball on weekends. She also helps with tasks around the house, like pulling weeds in the garden and sweeping the porch. Which of the following describes a possible benefit of Jackie's physical activity? (1 point) a Jackie may be less likely to commit to a healthy future. b Jackie may have an increased chance of disease. c Jackie may maintain healthy body fat levels. d Jackie may require more assistance performing daily tasks.

Answers

Answer:

The correct answer is - C) Jackie may maintain healthy body fat levels.

Explanation:

Jackie has a very active daily and on weekends routine that includes riding the bike, playing volleyball, pushing weeds, and sweeping the porch. The activities that Jackie is performing daily as well as the time that she spends on exercise may help her to maintain body fat levels.

Being physically active helps in maintaining fat levels in the body of an individual, and it is healthy for the individual.

Thus, the correct answer is - C) Jackie may maintain healthy body fat levels.

Plants cause weathering, too. A seed that falls into a crack in a rock may grow there. Growing roots may push on and enlarge the crack, What is this process called Question 2 options: chemical weathering mechanical weathering root-pry pedalfer

Answers

Answer:

c. root-pry

Explanation:

i did the test

The process by which a seed enters a rock fracture and the expanding roots push to widen the fissures is known as mechanical weathering.

What do you mean by mechanical weathering?

Machine-induced weathering Mechanical weathering, sometimes referred to as physical weathering and disaggregation, causes rocks to break down. Water, whether liquid or solid, is usually present during mechanical weathering. For instance, liquid water may seep through fractures and fissures in rock.

You may get mechanical weathering from

the reduction in pressure produced on by the removal of subsurface rock.

Water freezes and thaws in the granite's crevices.

Salt crystals are developing inside the rock.

cracking brought on the plant roots and exposed by digging animals

The information is ,

Let's say the weathering looks like A.

Now, plants are to blame since a seed that falls into a fracture in a rock and the seed's expanding roots push and widen the original gap

Weathering from mechanical sources and one mechanical weathering mechanism that fractures rocks is the freezing and spreading of ice in rock cracks.

Moreover, mechanical weathering reduces rocks into microscopic fragments, increasing the surface area of the material as a whole.

Hence, the method is mechanical weathering.

Click here for additional information about mechanical weathering.

https://brainly.com/question/27233034

#SPJ6

In a tropic level, energy flows from the producer to the primary consumer and to a secondary consumer. True False

Answers

Answer:

True

Explanation:

This is true because in an energy flow, the primary producers such as plants produce their own foods by using energy from the sun. These primary producers are consumed by primary consumers such as rabbits for food, while secondary consumers such as snakes would consume the primary consumers.

By so doing, energy flows from one trophic level to the other.

PLS HELP ME FAST I NEED TO DO IT NOW
I WILL GIVE YOU 45 POINT

Answers

Answer:

A) so the conditions for the expirament don’t affect the outcome

b) to make sure the results are conclusive and accurate

Explanation:

An arrow is shot at an angle of 35° and a velocity of 50 m/s. How long does it take to return to its original starting height?

Answers

Answer:

4.02 s

Explanation:

From the question given above, the following data were obtained:

Angle of projection (θ) = 35°

Initial velocity (u) = 50 m/s

Acceleration due to gravity (g) = 10 m/s²

Time of flight (T) =?

The time of flight of the arrow can be obtained as follow:

T = 2uSineθ / g

T = 2 × 35 × Sine 35 / 10

T = 70 × 0.5736 / 10

T = 7 × 0.5736

T = 4.02 s

Therefore, the time taken for the arrow to return is 4.02 s

According to evidence presented in both the text and video, which statement is the most accurate regarding the relationship between stress and the
immune system?
a.Stress activates foreign invaders that would otherwise lie dormant
b.Stress does not cause illness but restrains the immune system's ability to fight foreign invaders
c.Foreign agents invade the body and make it more susceptible to stressors
d.Stressors wear on the body, causing invading agents such as cancer to generate spontaneously

Answers

Answer:

Stress does not cause illness, but restrains the immune system's ability to fight foreign invaders

Explanation:

It's correct :)

In what way are all sound waves and light waves similar?

Answers

Answer:

Sound and light are similar in that both are forms of energy that travel in waves. They both have properties of wavelength, freqency and amplitude. Here are some differences: Sound can only travel through a medium (substance) while light can travel through empty space.

Answer:

Sound and light are similar in that both are forms of energy that travel in waves. They both have properties of wavelength, freqency and amplitude. Here are some differences: Sound can only travel through a medium (substance) while light can travel through empty space.

Explanation:

Hope this helped Mark BRAINLEST

A circus stuntman holds himself straight out by his arms from a vertical pole. If the stuntman's center of gravity is located 0.75 m away from the pole and he weights 650 N, how much force do is arms have to apply if they exert their force upwards at 0.10 m away from the pole? [4875 N]

Answers

Answer: 4875 N

Explanation:

Given

Stuntman weight is [tex]W=650\ N[/tex]

His center of gravity is located at [tex]x=0.75\ m[/tex] away from pole

If he applies an upwards force at 0.10 m away from the pole

Suppose  F is the applied force

To remain vertical, the torque of weight must be canceled by the vertical force

[tex]\Rightarrow 650\times 0.75-F\times 0.10=0\\\\\Rightarrow 650\times 0.75=F\times 0.10\\\\\Rightarrow F=\dfrac{487.5}{0.10}=4875\ N[/tex]

Why is coal considered a nonrenewable resource? Check all that apply.

Coal is burned to generate electricity.
Coal power plants give off large quantities of smoke and ash.
Coal forms so slowly that we could use up the supply that exists now.
Coal is available in limited amounts.

Answers

Answer:

cola forms so slowly that we could use up the supply that exists now

Answer: c and d

Explanation:

PLEASE HELP !!! Which product forms from the synthesis reaction between potassium (k) and iodine (I)?

Answers

Answer:

Pottasium iodide (KI)

Explanation:

product of this reaction is KI. this product is an ionic compound.

Does anybody know the formula needed to calculate distance given the values for mass, power, and time?

Answers

Answer:

Joules/second^2=(Newton×meter)/second^2.

Solving for mass: Kg= (second^3/ meter^2).

Compare the concepts of mass and weight. Name three differences.

Answers

Answer:

1a)Mass is the amount of matter in the body.

1b)Weight is the measure of the amount of force acting on a mass due to acceleration and gravity.

2a)Mass can never be zero

2b)Weight can be zero if no gravity acts upon an object. like in space

3a) Mass does not change according to location.

3b)Weight varies according to location.

A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534

Answers

Answer:

A. 13.3

Explanation:

First, we find the velocity of the electron in meters/sec, as follows:

[tex]v = \frac{d}{t}\\[/tex]

v = velocity of electron = ?

d = distance between plates = 2 cm = 0.02 m

t = time elapsed = 1.5 x 10⁻⁸ s

Therefore, using these values in the equation, we get:

[tex]v = \frac{0.02\ m}{1.5\ x\ 10^{-8}\ s}\\\\v = 1333333.33\ m/s[/tex]

Now, we convert this to million m/s:

[tex]v = (1333333.33\ m/s)\frac{1\ million\ m}{100000\ m}\\\\v =13.3\ million\ m/s[/tex]

Therefore, the correct answer is:

A. 13.3

Why is this statement false?
As the temperature of water is decreased from 4C to 0C contraction occurs.

Answers

The statement is false because as the temperature of water is decreased from 4C to 0C, expansion occurs.

You should understand that this is very weird behavior for any compound ... within a small temperature range, the stuff actually gets bigger as it gets colder.  That's why cubes float in your sody, and bergs float in the ocean.

Water is one of only two known substances that do this.  And if water didn't do it, then life on Earth would not be possible.  

Hmmm....

There is not contraction, Instead expansion occurs .

We know density of water is temperature dependant .

at 4°C water has max density so least volume as density is indirectly proportional to volume.

at 0°C density decreases so volume increases

"True or False": Because action and reaction forces are equal in magnitude, they will produce the same acceleration in both objects involved.

True. Forces that are equal in magnitude always result in the same acceleration.
True. The same acceleration will result because the two objects are acting on each other.
False. Acceleration is dependent on the mass of the object that is accelerated.
False. Even though both objects experience an equal force, only one will accelerate.

Answers

True im not 100% sure but I tried.

a = F/m is an explanation of
in  Physics

Answers

Answer:

The equation a=F/m or the acceleration is equal to the net force of an object divided by that object's mass, is an equation derived and explained by Sir Issac Newton's second law of motion. Newton's second law of motion states that the force of an object is equal to the mass times the acceleration of that object.

Which two elements are the most abundant in the Earth's crust? A. silicon and oxygen B. silicon and magnesium C. iron and nickel D. iron and magnesium

Answers

Answer: A. silicon and oxygen

Explanation:

The two most abundance elements in earth's crust are silicon and oxygen.

The most abundant element in earth's crust is Oxygen (O) which has a percentage composition of 46.6%.  Oxygen is mainly present as silicates, carbonates, sulphates etc.

The second most abundant element in earth's crust is Silicon (Si) which has a percentage composition of 27.7% . Silicon is present in the form of silicates.

The third most abundant element in earth's crust is aluminium (Al) which has a percentage composition of 8.1 %.

The fourth most abundant element in earth's crust is Iron (Fe) which has a percentage composition of 5.0 %.

Answer:

A

Explanation:

Which of the following is true about the diameter of a circle?
A. The diameter is twice the length of the radius.
B. The diameter is twice the length of the circumference.
C. The diameter is half the length of the circumference.
D. The diameter is half the length of the radius.​

Answers

Answer:

option A

Explanation:

the diameter is twice the length of the radius

hope it helps

How do scientists use patterns?
A. To organize results
B. To describe how something is made
C. To predict what might happen next
D. To send messages to other scientists​

Answers

Answer:

c because you see with your eyes and c rhymes with eyes

What causes the pressure in a fluid

Answers

Answer:

The pressure in a liquid is due to the weight of the column of water above. Since the particles in a liquid are tightly packed, this pressure acts in all directions. For example, the pressure acting on a dam at the bottom of a reservoir is greater than the pressure acting near the top.

Answer:

Fluid pressure can be caused by gravity, acceleration, or forces in a closed container. Since a fluid has no definite shape, its pressure applies in all directions.

Explanation:

the effect of current electricity
is
1.thunderstorm
2.lightning
3.friction
4.operating computer
pls choose one​

Answers

Answer:

(3 ) friction hope this is correct


An individual with a mass of 105 kg moves forward with a momentum of 575 kg-m/s. How fast are they traveling?

Answers

Answer:

5.47 m/s

Explanation:

p=ma

575=105v

v=575/105

v=5.47 m/s

mark as brainliest

Other Questions
3/4x 2 1/3 what is the answer to this question EnglishFlowers for Algernon question How is an IQ defined by the various characters (April 21)? which part in a mosque might be blocked 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! of sales tax is 6%, what is the final price of a Microwave oven whose list price is $110.00? 1. How do you think thermal energy drives the water cycle?Waves roll on the ocean under a cloudy sky. The sun is visible behind the clouds.2. How does this photo of a volcano erupting during sunset illustrate the two main sources of thermal energy that drive important processes on Earth? What is the probability that Mary will get an "11"? Hlp meeee (convert the improper fraction to a mixed number Please help TIA!!!!!!!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 Raymond needs to cover the entire surface area of the square based pyramid with paper what is the minimum amount of paper he will need HELPPPPPWhat is the initial value of the exponential functionshown on the graph?0 1O 2O 4 Read the following sentence with a misplaced modifier:Sparkling in the midday sun, the birds splashed and preened in the water.Which revision places the modifier correctly?Sparkling in the midday sun, the water birds splashed and preened.Water, sparkling in the midday sun, the birds splashed and preened in it.The birds, sparkling in the midday sun, splashed and preened in the water.The birds splashed and preened in the water sparkling in the midday sun. What two numbers have a sum of 215 and a difference of 137 Kenna has a mass of 30 kilograms. Whats her weight in newtons? Assume that acceleration due to gravity is 9.8 N/kg. why do countries become conquered? Ill give brainliest and a 5 star review for the best answer Do you think your town or neighborhood has an ecosystem? If you dont think so, explain why not. If you do think so, what are the producers, consumers, and decomposers in the ecosystem? What roles do humans play in this ecosystem? Which is the simplified expression for 3^-4*2^3*3^2/2^4*3^-3 How did democracy expand or change under Andrew Jackson? Steam Workshop Downloader