The sequence of nucleotides in a single strand of DNA is shown. TGA - GTG - AAT - CAT. Which of the following represents the complementary DNA strand?
CAG ACA GGC TGC
ACU CAC UUA GUA
ACT CAC TTA GTA
GTC TGT CCG ACG

Answers

Answer 1

Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.


Related Questions


A scientist studying a tissue sample from a sheep under a microscope finds some cells in metaphase II.
Which of the following organ did the tissue sample come from?

Answers

The organ the tissue sample was collected from is a reproductive organ such as testes or ovary.

What is metaphase II?

Metaphase is a stage of mitosis and meiosis, that follows prophase and comes before anaphase, during which condensed chromosomes become aligned before being separated.

Metaphase occurs once in mitosis but occurs twice in meiosis, which gives it the suffix metaphase I and II.

Meiosis is a kind of cell division of a diploid cell into four haploid cells, which develop to produce gametes. In essence, meiosis is for reproductive purposes solely.

According to this question, a scientist studying a tissue sample from a sheep under a microscope finds some cells in metaphase II. This means that the tissue sample emanated from a reproductive organ.

Learn more about meiosis at: https://brainly.com/question/29383386

#SPJ1

la structure des mitochondries

Answers

Answer:

this is the answer

my hombre

Explanation:

which of the following statements is true? a.) pyruvate is produced when a glucose molecule undergoes glycolysis. b.) pyruvate is a byproduct of atp production. c.) glycolysis turns pyruvate into glucose. d.) phosphorylation is another word for glycolysis.

Answers

When a glucose molecule engages in glycolysis, pyruvate is formed.

Explain glycolysis:

Nearly all sorts of organisms have evolved a metabolic process and anaerobic energy source called glycolysis. The Embden-Meyerhof pathway is another name for the process, given in honour of the key figures in its discovery and comprehension. It serves a purpose in anaerobic respiration because it doesn't need oxygen, but it is also the initial stage in cellular respiration. Molecules of glucose, the most important organic fuel for plants, microorganisms, and animals, are oxidized during the process. A majority of cells favor glucose (although there are exceptions, such as acetic acid bacteria that prefer ethanol). Per glucose molecule, glycolysis uses up 2 ATP molecules and generates 4 ATP, 2 NADH, and 2 pyruvates.

To learn more about pyruvates visit:

https://brainly.com/question/9507938

#SPJ4

FILL IN THE BLANK. The action potential traveling down the T tubule causes the sarcoplasmic reticulum to release ____ ions into the fluids surrounding the myofibrils.​

Answers

The action potential traveling down the T tubule causes the sarcoplasmic reticulum to release calcium ions into the fluids surrounding the myofibrils.

What is action potential?

The fundamental unit of the neurological system is the neuron (also known as a nerve cell). An electrical impulse known as an action potential plays a role in how neurons transport messages throughout the body.

This procedure, which takes place when neurons fire, enables a nerve cell to send an electrical signal down the neuron's axon (the part of the cell that transports nerve impulses out from the cell body) in the direction of other cells. This signals the muscles to contract in response.

Steps in action potential:

Depolarization, repolarization, hyperpolarization

Cells that signal via action potentials are neurons and muscle cells

The sudden shift in voltage or action potential is initiated by stimulus. In the patch-clamp mode, the cell must receive enough current to elevate the voltage over the threshold voltage required to initiate membrane depolarization.A sudden increase in membrane potential that opens sodium channels in the cellular membrane and causes a significant inflow of sodium ions causes depolarization.Rapid sodium channel inactivation and a significant potassium ion outflow brought on by active potassium channels cause membrane repolarization.A lower membrane potential known as hyperpolarization is brought on by the efflux of potassium ions and closure of the potassium channels.When the membrane potential reaches the resting voltage that existed before to the shock, the body is said to be in a resting condition.

Hence, The action potential traveling down the T tubule causes the sarcoplasmic reticulum to release calcium ions into the fluids surrounding the myofibrils.

To learn more about action potential click on the link

https://brainly.com/question/13606928

#SPJ4

Complete the sentences to review the process of T-cell activation. Then move the sentences into the correct order. T-cell activation begins when an ____________ delivers antigen to a CD4 or CD8 T cell. In contrast, ____________ T-cell activation requires the action of ____________ cells in order to differentiate into memory CD8 cells and activated CD8 cells. In the case of a ____________ cell, it can differentiate into T helper ____________ cells which will activate ____________ cells. Activated CD8 cells will mount a direct attack on target cells through the action of ____________ , which punch holes in membranes, and ____________ , which then enter through these passageways. It may also differentiate into a T helper ____________ cell for B-cell activation, or T helper ____________ or T regulatory cells for modulation of the ____________ response.

Answers

1. Antigen presenting cell (APC)

2. inflammatory (Cytotoxic)

3. TC (CD8)

4.  CD4+ () cell

5.  II (TH1)

6. T-cytotoxic (TC, cytotoxic T cells)

7.  perforins

8. granzymes

9. I (TH1) cell

10. immune

The development of both cellular and humoral immunity depends on T cell antigen activation, a critical stage in the adaptive immune response. In addition to helping B cells and producing cytotoxic T cell responses, activation is necessary for efficient CD4 T cell responses. In the two signal paradigm, T cells might be activated by concurrently receiving signals from cytotoxic T cells costimulatory molecules and T-cell antigen recognition, or signal-1 and signal-2.

learn more about cytotoxic T cells here:

https://brainly.com/question/27459085

#SPJ4

the first fossils of animals with hard parts appeared about 541 million years ago. what percentage of geologic time does the fossil record represent? express your answer as a percentage with two significant figures

Answers

The percentage of geological time is 20%.

What are fossil records?

Fossils are the remains or signs of extinct living things. Examples include fossilized bones, shells, exoskeletons, animal or microbe imprints in stone, amber-preserved artifacts, hair, petrified wood, oil, coal, and DNA traces.

The collection of all known and undiscovered fossils during a period of time is known as the fossil record. Scientists can learn more about the Earth's past through fossil records. To understand the evolution of living things, fossil records are used. Understanding how life has evolved over time is useful.

Hence the answer is the geological time that has been mentioned in the question represents 20%.

To learn more about fossil records follow the link:

https://brainly.com/question/29651546

#SPJ4

in the molecule below, which atom has the largest partial negative charge? category:bromochlorofluoroiodomethane - wikimedia commons group of answer choices cl br f i c\

Answers

In the molecule below, the atom that has the largest partial negative charge is F which is Flourine.

Electronegativities of halogens :

F = 4.0

Cl = 3.16

Br = 2.96

I = 2.66

Cl, Br opposite bonds result  = 3.16 -2.96  = 0.2 on Cl atom

F , I  opposite bonds result  = 4.00 - 2.66 = 1.34 on F

So more negative charge on F.

Electronegativity is a compound property that portrays the property of an atom or a functional group to draw electrons toward itself. The electronegativity of a molecule is impacted by the two nuclear numbers and the distance its valence electrons dwell from the charged cores.

To learn more about organic elements and halogens,

https://brainly.com/question/14623424

#SPJ4

true or false: one way to help conserve coastal areas and the organisms that live there is through the inclusion of marine protected areas (mpas)

Answers

The answer is false

Due to ______, equatorial regions of earth have warm temperatures year-round, and nonequatorial regions experience lower temperatures, less light, and seasonal changes.

Answers

The earth's equatorial and nonequatorial areas both experience warm temperatures all year round as a result of global warming.

What is the primary reason for seasonal fluctuations in temperature?

The spin axis of the earth is inclined to its orbital plane. This triggers the change of the seasons. It is summer where the axis of the earth faces the sun. When the axis of the globe is facing away, winter is to be expected.

What factors affect a place's temperature?

Natural factors that affect a region's temperature trends include latitude, elevation, and the existence of ocean currents.A region's precipitation patterns are impacted by things like its closeness to mountain ranges and the direction of the prevailing winds.

To know more about temperature visit :-

https://brainly.com/question/11464844

#SPJ4

true or false the lymphatic system circulates lymph fluid through vessels and lymph nodes to filter out pathogens

Answers

Yes, the statement is True, the lymphatic system circulates lymph fluid through vessels and lymph nodes to filter out pathogens.

Additionally, the lymphatic system aids in the body's defense against dangerous germs (viruses, bacteria, and fungus). These germs are eliminated via the lymph nodes, which are tiny tissue clusters dispersed throughout the lymphatic system. T-cells and B-cells, two types of lymphocytes found inside lymph nodes, are used by the body to combat infection. To stop the spread of diseases, B cells produce antibodies, which are unique proteins that bind to and destroy disease-causing microorganisms. Most of our lymph nodes are found in the groin, armpit, and neck regions. They are located in the pelvis, chest, and lymphatic pathways and serve as blood filters as well. An infected person's lymph nodes develop into a bacterial haven. For instance, if the throat is sick, the lymph nodes in the neck may expand. For this reason, when a patient complains of a sore throat, medical professionals check the neck for enlarged lymph nodes, often known as enlarged "glands." It's known as lymphadenopathy.

To know more about lymph please refer: https://brainly.com/question/10743182

#SPJ4

assume that you have a summer fellowship to study vaccine production for an agent of an emerging infectious disease. you infect several animals with the agent and watch the animals get sick and recover within three to four days. three months later, you try to reinfect the same animals with the same agent with no success. what can you conclude about the animals' defense to this new agent?

Answers

The animals get sick and recover within three to four days. three months later,  try to reinfect the same animals with the same agent with no success. To conclude about the animals' defense to this new agent is a pathogen

A pathogen is an organism that causes disease and is able to trigger an immunological response in other creatures. Viruses, bacteria, and nematodes are examples of organisms that can behave as pathogens.Various tests have been run to identify the infectious agent. The animals are protected against illness through trypsin digestion. Given that protein digestion interferes with an organism's ability to spread disease, the infectious agent must therefore be a protein

Learn more about pathogen by using this link:

https://brainly.com/question/13286359

#SPJ4

What is the total number of atp molecules produced through cellular respiration per molecule of glucose?.

Answers

One molecule of glucose can be converted into 30 to 32 ATP during the process of cellular respiration in an eukaryotic cell.

36 or 38 ATP are produced during cellular respiration?

As a result, during cellular respiration, one glucose molecule can produce up to 36 ATP molecules. A series of procedures known as glycolysis converts glucose into two molecules with three carbons each, known as pyruvate, and uses them to produce energy.

How does glucose yield 38 ATP?

A net ATP gain of 38 is produced by aerobic respiration from one glucose molecule. It is made up of the ATP produced by the link reaction, the TCA cycle, oxidative phosphorylation, and glycolysis in the electron transport system.

To know more about cellular respiration visit:-

https://brainly.com/question/13721588

#SPJ4

Frequency of failure and network recovery time after a failure are measures of the _______ of a network.

Answers

Frequency of failure and network recovery time after a failure are measures of the reliability of a network. So potion (b) is the correct answer.

Network recovery can be described as the processes that shape the recovery and recovery of work or business operations over computer networks.

Network recovery is important because it enables security and makes data more accessible when updating data over the network when using the Internet.

Network recovery errors mediate the formation of erroneous system results that degrade computer system performance. Ideas for reliability of network were determined, along with performance, failures, and recovery actions.

Complete question:

Frequency of failure and network recovery time after a failure are measures of the _______ of a network.

A) Performance

B) Reliability

C) Security

D) Feasibility

Learn more about Network recovery from:

https://brainly.com/question/2323271

#SPJ4

Now that you have seen the difference in the smear preparation after simple methylene blue staining, which of the following is correct regarding your smear now?
The addition of methylene blue helps show helps show the intact appearance and localization of the cells, compared with no staining
The addition of methylene blue makes visualization some bacterial cell characteristics more apparent, compared to no staining
Addition of methylene blue highlights the bacterial cell nucleus and organelles that were difficult to discern without stain
The addition of methylene blue helps visualize the shape and arrangements of bacterial cells that were difficult to discern without stain.

Answers

The addition of methylene blue: helps show the intact appearance and localization of the cells, compared with no staining, helps visualize the shape and arrangements of bacterial cells that were difficult without stain

It can be added to a solution to dye RNA and DNA for visual analysis. Wine Microbiology Application: Methylene blue staining can be used to determine cell mortality. When methylene blue stain is applied to a sample, a healthy cell causes the stain to become colorless. Methylene blue acts as an alternative electron acceptor, reversing NADH inhibition of hepatic gluconeogenesis and inhibiting the transformation of chloroethylamine into chloroacetaldehyde, as well as inhibiting multiple amine oxidase activities, preventing the formation of chloroacetaldehyde.

Learn more about Methylene blue here:

https://brainly.com/question/9784741

#SPJ4

which of the statements is accurate? the same amount of oxygen enters the blood through diffusion as is transported by circulation. larger, more complex animals and smaller, simpler animals rely on bulk flow and diffusion to deliver oxygen to their cells only oxygen, not carbon dioxide, moves across the respiratory surface by diffusion. circulation requires a pump to generate pressure to drive flow, whereas ventilation does not. circulation requires a pump to generate pressure to drive flow, whereas ventilation does not.

Answers

The same amount of oxygen enters the blood through diffusion as is transported by circulation. This statement is accurate.

Circulation requires a pump to generate pressure to drive flow, whereas ventilation does not. This statement is false. Atmospheric pressure drive pulmonary ventilation. The same amount of oxygen enters the blood through diffusion as is transported by circulation. This statement is true. Larger, more complex animals and smaller, simpler animals rely on bulk flow and diffusion to deliver oxygen to their cells only oxygen, not carbon dioxide, moves across the respiratory surface by diffusion. This statement is false, since carbon dioxide also move across by diffusion.

To learn more about ventilation visit the link- https://brainly.com/question/1121893

#SPJ4

imagine you discover a mutation in a eukaryotic gene that leads to loss of function of the protein that it encodes. you determine the mutant gene’s nucleotide sequence from start site for transcription to the termination point of transcription and find no differences between the mutant gene and the normal gene. where on the dna could the mutation be?

Answers

Mutation happens in enhancer and a promoter proximal element.

what is the role of enhancer and promoter in transcription?

Enhancers are brief nucleotide sequences that increase the genome's rate of transcription. Large nucleotide sequences called promoters start the transcription process.

Loss of function of the protein that is encoded by a eukaryotic gene due to mutation. As a result of the mutant gene's altered nucleotide sequence from the transcriptional start site to the termination point, the enhancer and promoter regions on the DNA may have changed. However, there are no differences between the mutant gene and the normal gene.

To learn more about transcription https://brainly.com/question/1048150

#SPJ4

heterotherms maintain high internal body temperatures through internal metabolic production of heat true or false

Answers

Through internal metabolic heat production, heterotherms maintain high body temperatures.

Heterotherms are organisms with a body temperature control range that lies between that an ectotherm and an endotherm. Some endothermic ('warm-blooded') small mammals and birds may lower their metabolic rate during a particular season or even time of day, causing their body temperature to drop and enter a condition of torpor. This saves small animals, like hummingbirds and some rodents, the relatively expensive expense of keeping a steady body temperature when there is a lack of food or other unfavorable circumstances. Partial endothermy is another name for this tactic. On the other end of the spectrum, certain creatures that are typically thought of as ectothermic (or "cold-blooded") have the capacity to generate heat internally for brief durations, momentarily boosting their body temperature to enable activity when the surrounding environment is chilly. Many insects, including bumblebees, have been shown to shiver in cold weather in order to raise their body temperature enough to fly. We can refer to this as facultative endothermy.

To learn more about body temperature, refer:-

https://brainly.com/question/23270157

#SPJ4

A mutation occurs in a population of rabbits affecting ear length. After multiple generations, 30% of the population exhibit the new recessive phenotype for short ears. Use the Hardy-Weinberg equation to determine the genotypic frequencies of the rabbit population. Show all work in your answer.

Answers

We'll align the following generation of multi-state scientific standards with two alleles in a population of wild rabbits represented by dried beans. Hardy-Weinberg Allele frequencies in a given population over time can be compared using equilibrium.

In Hardy-Weinberg, what are P and Q?

P stands for population prevalence of the dominant allele. In the population, q equals the frequency of the recessive allele. p2 = homozygous dominant individuals as a percentage. the proportion of homozygous recessive people (q2). Individuals with heterozygotes are represented by 2pq.

How do you calculate Hardy-Weinberg with 3 alleles?

Hardy Weinberg Calculations for Multiple Alleles at a Single Locus. For a gene locus segregating more than two alleles, the frequency of each allele is the frequency of its homozygote plus 1/2 the sum of the frequencies of all heterozygotes in which it can occur.

To know more about Weinberg visit :-

https://brainly.com/question/16823644

#SPJ4

multicellular gameotophytes are the product of spores from a) stigmas and sepals. b) ovules and anthers. c) ovules and petals. d) anthers and stigmas.

Answers

Option B: The multicellular gametophytes are produced by spores from ovules & anthers.

The gametophyte is one of the two alternative multicellular phases in the life cycles of plants and algae. It develops from a single-chromosome haploid spore into a multicellular haploid organism. Gametophyte refers to the sexual stage in the life cycle of plants and algae.

To produce haploid spores, meiosis takes place in diploid sporophyte cells. Each spore undergoes mitosis, resulting in the production of a multicellular, haploid gametophyte. To produce gametes, the gametophyte must go through mitotic divisions. The diploid sporophyte is created when two gametes unite.

Learn more about gametophytes at

https://brainly.com/question/13050468?referrer=searchResults

#SPJ4

Match the region of the spinal cord with the number of spinal nerve pairs that are associated with it.
i) Five
ii) One
iii) Eight
iv) Twelve
a) Cervical
b) Lumbar
c) Coccygeal
d) Thoracic

Answers

The given regions of the spinal cord are matched with the associated number of spinal nerve pairs.

The spinal cord of the human body is protected by the vertebral column and helps the body stay upright by providing proper support. It consists of five sections, the component regions, which are the cervical, lumbar, sacral, coccygeal, and thoracic. It is the main pathway of communication between the body and the brain.

This is how it will get matched.

a) Cervical - iii) Eight

b) Lumbar - i) Five

c) Coccygeal - ii) One

d) Thoracic - iv) Twelve

Hence, this is how it works out.

Learn more about the Spinal Cord on

https://brainly.com/question/23916836?referrer=searchResults

#SPJ4

there are 24 species of hornbills that live in africa, all descended from a common ancestor. there are differences in nesting behavior, feeding morphology, and the habitats in which they are found, which include forests, woodlands, and savannahs. which statement best reflects how ecology and competition could have played a role in diversification of the hornbill lineages?

Answers

During the evolution of hornbills, resource partitioning between various groups may have led to competitive exclusion and speciation.

Origin and diversification of hornbill:

A remarkable group of Palaeotropical birds known for their unusual morphology (casque) and behaviour are hornbills. Significant interspecific variation may be seen in hornbill food, habitat utilisation, distribution, and social structure. Their mutualistic interactions with tropical fruits also contribute significantly to environmental services. Conflicting theories exist regarding hornbills' origin, rate of diversification, and biogeography, but their evolutionary history is still unknown. Although a gradual accumulation of molecular data has revealed intriguing phylogenetic relationships, methodological restrictions and inadequate sampling have left gaps and led to inconsistent results. This is true even though a thorough cladistic analysis of phenotypic data has revealed unresolved taxonomic uncertainties within the family.

As a result, the evolutionary paradigm used to analyze the group's variety is insufficient.

To learn more about hornbill visit:

https://brainly.com/question/27262263

#SPJ4

in humans, the ability to test the chemical phenylthiocarbamide (ptc) is dominant to the inability to test this chemical. if a population is in hardy-weinberg equilibrium for the gene that determines the ability to taste ptc and 64% of the individuals in the population can taste ptc, what percentage of the population is heterozygous for this gene?

Answers

If 64% of people in a population have the gene that determines their capacity to taste PTC (phenylthiocarbamide) and this population is in Hardy-Weinberg equilibrium, then 48% of the population is heterozygous for this gene.

An organosulfur thiourea with a phenyl ring is phenylthiocarbamide, also called phenylthiourea. It has the peculiar quality that, depending on the taster's genetic makeup, it either tastes extremely bitter or barely detectable.

All human populations investigated to date have both individuals who can and those who cannot taste the bitter substance phenylthiocarbamide (PTC) and similar compounds is unknown why this feature has persisted in the population, however, this polymorphism could have an impact on thyroid metabolism, food intake, or nutritional status. Uncovering the gene product that causes this phenotype and characterizing it would shed light on how bitter tastes are perceived. Although this feature is frequently thought to be a straightforward Mendelian trait, with one gene and two alleles, a recent linkage analysis identified the main locus on chromosome 5p15 and suggested the existence of a second locus on chromosome 7. Between single-gene illnesses and polygenic features, the development of techniques to identify these genes will offer a good transition.

To learn more about phenylthiocarbamide, refer:-

https://brainly.com/question/14551381

#SPJ4

A number of evolutionary studies show a strong phylogenetic link between prokaryotic and eukaryotic cells. Which of the following is the best statement about the evolutionary origins of eukaryotic cells?
Eukaryotes probably evolved from a lost prokaryotic lineage, which could not be placed among either the Archaea or Bacteria domains.
Eukaryotes shared a common ancestor with species in the domain Archaea.
Eukaryotes shared a common ancestor with species in the domain Bacteria.
Eukaryotic

Answers

A number of evolutionary studies show a strong phylogenetic link between prokaryotic and eukaryotic cells, Eukaryotes shared a common ancestor with species in the domain Archaea is the best statement about the evolutionary origins of eukaryotic cells

The "informational" genes of eukaryotic organisms are most closely related to archaeal genes, while the "operational" genes are most closely related to bacterial genes. According to recent evidence, Archaea and Eukarya are more closely related to each other than either is to Bacteria. The evidence suggests that all three domains of life share a common ancestor who lived more than 3 billion years ago (bya). This ancestor gave rise to two lines of descent. In the years since, molecular phylogenetic analyses have revealed that eukaryotes and Archaea are sister groups in the tree of life. During the genomic era, it became clear that eukaryotic cells have a mix of archaeal and bacterial characteristics, as well as eukaryotic-specific characteristics.

Learn more about eukaryotes more:

https://brainly.com/question/4644590

#SPJ4

the experiment of selective breeding of fruit flies for distinct differences in negative or positive geotaxis is an example of

Answers

The experiment for selective breeding of all fruit flies for their differences in negative or any positive geotaxis type is an example of QTL analysis.

QTL evaluation permits researchers in fields as numerous as agriculture, evolution, and medicinal drug to hyperlink positive complicated phenotypes to unique areas of chromosomes. The purpose of this system is to discover the action, interaction, number, and particular region of those areas. QTL mapping involves evaluating alcohol-associated behaviors in those traces and figuring out styles of acknowledged genetic markers shared via way of means of traces with the identical behaviors.

The markers permit the identity of possibly places of genes that impact alcohol-associated behaviors. Interval mapping. Lander and Botstein (1989) advanced at the pre- vious unmarried marker procedures via way of means of thinking about flanking markers. Their approach has been called "c language mapping," and is presently one of the maximum generally used techniques for figuring out QTLs in experimental crosses.

Learn more about selective breeding visit: brainly.com/question/13614055

#SPJ4

what is the process that involves an end product acting as an inhibitor of an earlier step in a metabolic pathway called

Answers

The process that involves an end product acting as an inhibitor of an earlier step in a metabolic pathway is called feedback inhibition.

Sometimes, in a process known as feedback inhibition, the byproducts of a metabolic pathway act as inhibitors of their own synthesis. For instance, hexokinase, the enzyme that creates glucose-6-phosphate, is inhibited by the first intermediate in glycolysis, glucose-6-phosphate. Cells can either increase the amount of a required (rate-limiting) enzyme or use activators to change that enzyme into an active conformation in order to support a certain process.

Cells can also use inhibitors to render an enzyme inactive or reduce the amount of an enzyme present in order to slow down or stop a pathway. Changes in the concentrations of important metabolites in the cell frequently cause such up- and down-regulation of metabolic pathways.

To know more about metabolic pathways, refer to the following link:

https://brainly.com/question/1263032

#SPJ4

After eating a large plate of spaghetti, an organism must break down the starch into it smaller monomer sugars using which reaction?
dehydration
hydrolysis
rehydration
photosynthesis

Answers

The organism must break down the starch into smaller monomer sugars using Hydrolysis reaction.

What is Hydrolysis?

Hydrolysis is a chemical reaction wherein water is used for the break down of chemical bonds existing between particular substances.

In hydrolysis, the water (H2O) molecules get attached to two parts of a molecule. One molecule of the substance gets H+ ion and the other molecule will receive the OH- group.

Polymers are usually broken down into monomers in hydrolysis.

Reaction of water with another compound results in the formation of two or more products.

Examples of hydrolysis are dissolving dissolving sulphuric acid in water or a salt of a weak acid or base in water where hydronium and bisulfate compounds are formed.

Hydrolysis  also helps in breakdown of proteins, fats, and complex carbohydrates in food.

Therefore, the organism must break down the starch into smaller monomer sugars using Hydrolysis reaction.

Learn more about Hydrolysis here: https://brainly.com/question/4352413

#SPJ4

Which list includes major events in the history of life on earth in the proper order, from earliest to most recent?.

Answers

Major events in the history of life on Earth include the emergence of prokaryotes, photosynthesis, the origin of eukaryotes, and the colonization of land by plants and fungus.

What initial indications of life did the Earth show?

The fact that the earliest indications of life on Earth are so basic makes sense. Earth's first fossilized life can be found 3.7 billion years ago. In old rock samples from Greenland, they were discovered to be well-preserved.

What are some of the first signs of life on Earth?

Stromatolite fossils and biogenic carbon fingerprints found in metasedimentary rocks from western Greenland that are 3.7 billion years old are the earliest signs of life. In Western Australia, 4.1 billion years old rocks that may have had "remains of biotic life" were discovered in 2015.

To know more about Earth visit:-

brainly.com/question/28190683

#SPJ4

Riya rides his bike 6 miles in 27 minutes. What is his average speed in miles per minute? Be sure to include the equation for speed in your answer and show your work.

Answers

Answer:

162 miles per minute

Explanation:

27 times 6

6 times 7 is 42

last number is 2

and then you multiply 6 to 2

which equals 12 then you add the 4 that is above the 2

that equals 16

and the first two numbers is 1 and 6

and put it together

which equals 162

So 27 times 6 equals 162

27 × 6 = 162

Hope this helps!!!!

Answer:

1 mile each 4.5 minutes

Explanation:

27 min divided by 6 miles = 4.5

Riya rides his bike 1 mile each 4.5 minutes

a termite infestation is usually discovered when: group of answer choices reproductives emerge for mating flights when the colony number increases to 2000 all of the above workers go back to the nest with food

Answers

The answer is c) All of the above as Infestation of termites happens when the population of the colony gets increased. It happens when they mate.

The term infestation often refers to parasitic illnesses brought on by creatures like arthropods (such as mites, ticks, and lice) and worms, but it excludes (excepts) ailments brought on by protozoa, fungus, bacteria, and viruses, which are referred to as infections. Depending on where the parasites are in relation to the host, infestations can be classed as either exterior or internal. Although porocephaliasis can penetrate viscerally, external or ectoparasitic infestations, which include those involving mites, ticks, head lice, and bed bugs, are characterized by organisms that dwell largely on the exterior of the host. Internal (or endoparasitic) infestations, which include those involving worms (though swimmer's itch remains close to the surface), are conditions in which organisms dwell within the host.

The complete question is:

A termite infestation is usually discovered when:

a) When the colony number increases to 2000

b) Workers go back to the nest with food

c) All of the above

d) Reproductives emerge for mating flights

To learn more about infestation click here: https://brainly.com/question/21666246

#SPJ4

do you think it is possible to get the same benefits seen in the offspring from grooming and licking by the rat mothers if an unrelated rat were to do the grooming and licking?

Answers

Yes. It would not matter if the brushing and licking were performed by an adult who did not share a genetic background because epigenetic modifications might be induced by environmental factors.

Either endogenous or external diversity in epigenetic patterns exists in multicellular organisms. Exogenous is a cellular reaction to environmental inputs, whereas endogenous is produced through cell-cell signalling (for instance, during early development when cells are differentiating). A new branch of science called "epigenetics" demonstrates how environmental factors, such as childhood experiences, truly change how genes are expressed. Consequently, the dated notion that genes are "fixed in stone" has been debunked. The debate over nature versus nurture is over. The impact of stress as a potential transgenerational risk factor for depression, the impact of nutrition on the risk of diabetes and cardiovascular disease across generations, as well as other examples of epigenetic inheritance in humans, have all been reported.

Learn more about epigenetic by using this link:

https://brainly.com/question/2670031

#SPJ4

Other Questions
Henry is working from a USDA office. He has several tasks to perform today: 1) he logs onto his USDA computer to get started; 2) he faxes a sensitive document to his supervisor using a fax machine with the appropriate clearance; 3) he confirms some appointments and project due dates and enters them into his smart phone; and 4) he calls his supervisor on his cell phone to review the document he just faxed over. Which of Henry's actions was a mistake? A string of words that makes a complete idea is called a(n)_________A. sentenceB. verbC. nounD. adjective A sample of size=n83is drawn from a population whose standard deviation is=42Part 1 of 2(a) Find the margin of error for a95%confidence interval for. Round the answer to at least three decimal places.The margin of error for a95%confidence interval foris.Part 2 of 2(b) If the confidence level were99%, would the margin of error be larger or smaller? A red wagon with a mass of 7\, {\text{kg}}7kg7, start text, k, g, end text is moving with a velocity of 4\,\dfrac{\text{m}}{\text{s}}4 sm 4, start fraction, start text, m, end text, divided by, start text, s, end text, end fraction straight toward a blue wagon at rest. The red wagons mass is 777 times the mass of the blue wagon. The final velocity of the red wagon is 3\,\dfrac{\text{m}}{\text{s}}3 sm 3, start fraction, start text, m, end text, divided by, start text, s, end text, end fraction .What is the velocity of the blue wagon immediately after the red wagon collides with it? a puuck of mass m pslides across a horizontal surafe cand collides with a stationary, nonuniform rod that is pivoted about its left end in three configurations ap physics 37)quality chairs inc. (qc) manufactures chairs for industrial use. laura winters, the vice president for marketing at qc, concluded from market analysis that sales were dwindling for qc's standard three-foot chair due to aggressive pricing by competitors. qc's chairs sold for $550 whereas the competition's comparable chair was selling for $495. winters determined that a price drop to $495 would be necessary to regain market share and reach a targeted annual sales level of 10,000 chairs. cost data based on sales of 10,000 chairs:Budgeted QuantityActual QuantityActual CostDirect materials (board feet)88,50080,000$1,252,500Direct labor (hours)71,60074,025875,500Machine hours (hours)11,65011,500250,500Finishing and packing (hours)6,7506,650125,500If the profit per unit is maintained, the target cost per unit is:Multiple Choice$81.$171.$181.$276.$226. Caleb is buying a new bed costing 400. He pays of the total cost when he orders the bed and the rest on delivery. How much does he pay when he orders the bed? i need help with biology pls What helped the Whigs defeat President Van Buren in the 1840presidential election? 15 red cars to 19 blue cars Use to.______ Use a colon._______ Use fraction form._______/ write each ratio please help !! an older adult resident of a long-term care facility has a 5-year history of hypertension. the client has a headache and rate the pain 5 on a pain scale 0 to 10. the client's blood pressure is currently 142/89. which interventions should the nurse implement? (select all that apply) Prepare a December 31, 2020, balance sheet for Long Print Shop from the following: cash, $41,700; accounts payable, $29,700; merchandise inventory, $15,700; Joe Ryan, capital, $49,400; and equipment, $21,700. which form of government form takes on military rule? Rank the compounds below from lowest to highest viscosity based on their structures. (Hint: hydrogen bonds formed between molecules with N-H groups are weaker than those formed between molecules with O-H groups.)1-propanol, CH3CH2CH2OHpropane, CH3CH2CH3propanal, CH3CH2CH=O1-propanamine, CH3CH2CH2NH2Please help me out! I've been stuck on this problem for ages! an article reported that, in a study of a particular wafer inspection process, 356 dies were examined by an inspection probe and 201 of these passed the probe. assuming a stable process, calculate a 95% (two-sided) confidence interval for the proportion of all dies that pass the probe. (round your answers to three decimal places.) , in the past decade, there have been many volcanic eruptions. after an eruption, the lava flow leaves behind only bare rock, providing a surface for primary succession. which statement describes an important function provided by the first organisms to colonize the area that facilitates colonization by other organisms in later stages of succession? Pythagoras theorem How do i find the n calculate the braking distance traveled as the speed of the car is reduced from 21 m/s to 0m/s Lola puts $150 into a bank account The account pays 4% per annum simple interest work out the total amount of mo Laurence was just asked to be the main speaker at a data science conference in LasVegas. He'll deliver a 30-minute presentation for the crowd of 500 data scientists.What would you call his speech?