Try this investigation.

This supply is needed:

gallon jar (or other large, glass container)


Follow these directions and answer the questions.

1. Select one of the following habitats and set up a living community. Indicate the habitat you choose. You may use an area nearby to gather organisms or environmental factors for your habitat.

Freshwater aquarium

Woodland terrarium

Marine aquarium

Desert terrarium

Aqua-terrarium

2. Study your habitat for several weeks to observe and record any changes. In a 250-word report, describe your habitat and answer the following questions.

What kinds of organisms does your habitat contain?

What changes occurred in your habitat after a period of time?

Answers

Answer 1

Answer:

I deceided to do the project with fresh water from my creek in the backyard. I was hoping to get some living organisms in the water when i scooped it up.The first week there wasnt many changes i did notice the water was turning slightly a different color but no major changes. The secound week my water was more of a green color and not as much brownish clear. There was also some green stuff growing which i think that was alge.The third week my water was all the way green and i noticed there was some stuff floating in the water but i dint see any living organisms. There was also more alge in it than last time.

Explanation:

Some spelling is wrong but overall i got a good grade on this i hope this can help :)


Related Questions

So basically how do i ask my best friend out?

Answers

Answer:

Explain

well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer:

C

Explanation:

How have hominid skulls changed over time? What are some of the reasons for those
changes?

Answers

Answer:

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Explanation:

Give brainlist me please

Skull and face changes define modern humans - Harvard Gazette

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Look at the tropical grassland ecosystem.

Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.

There are more zebra than the carrying capacity of the pictured ecosystem. This represents a

climax community
biological surplus
peak phenomenon
sigmoid phenomenon

Answers

Answer:

It is B Biological Surplus

Explanation:

Biological Surplus means that a species population has grown too big, above carrying capacity

What that determines if a cell is eukaryotic. *

Answers

To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
there’s not any answer choices, but eukaryotic cells possess a clearly defined nucleus. they also have more organelles

Which compounds are not soluble in water?

Answers

answer :

All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)

Exceptions :

Salts of NH4 +, and the alkali metal cations

Answer:

All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides

Explanation:

The Earth’s rotation is the only thing that impacts wind

Answers

Answer:

false

Explanation:

While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.

Answer:

False

Explanation:

This is false because the earth goes one way but the wind can go all kinds of ways

What material is the objective lens made of in UV fluorescence microscopy

Answers

Answer:

quartz

Explanation:

At the molecular level, how do scientists know a new species has arisen?

Answers

Answer:

DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.

Explanation:

? :-)

The graph shows the change in seabird mortality rates in New Zealand waters due to illegal, unreported, and unregulated fishing (IUU) and the implementation of bycatch remediation measures in 2004. What conclusion can be made about the impact of the remediation measures that were used?

Illegal and unregulated fishing practices continue to cause increases in bird bycatch numbers, in spite of the new measures.
Legal fishing practices have caused the new remediation measures to become more effective.
The measures virtually eliminated all of the bird bycatch.
The measures used showed very little impact on the overall seabirds caught in fishing lines.

Answers

According to the graph, the measurements practically eliminated all incidental captures, as shown in the third answer option.

What does the graph show?Illegal capture practices show a high performance between 1997 and 2003.Illegal capture practices show a low performance from 2004 and this performance tends to fall in the next years until it presents very low values.Legal capture practices maintain a balanced performance.

The decrease in the performance of illegal practices from 2004 onwards, shows how the remediation measures were efficient in reducing the activity of these practices and providing a better environmental well-being.

More info about graphics on the link:

https://brainly.com/question/14323743

Which animal phylum was the first to develop a dorsal nerve cord a backbone?

Answers

Answer:

Chordates?

Explanation:

Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>

Answers

Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

How human impacted the environment?

Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.

So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

Learn more about environment here: https://brainly.com/question/17413226

Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms​

Answers

Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

What is social media?

Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.

Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Learn more on social media here,

https://brainly.com/question/3653791

VIDA chart for biology

Answers

Answer:

Yes you are right I didn't get the question too.

What is salinity and how does it change?.

Answers

A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.

Salinity is controlled by a balance between water removed by evaporation and freshwater added by rivers and rain. changes in evaporation and rainfall, ocean currents, melting ice, and freshwater influx from rivers or streams can influence patterns of sea surface salinity, making some regions saltier and other regions fresher over time.

What is the great pacific trash gyre?

Answers

Answer:

The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.

Name the five carbon sugar in a DNA neucleotide

Answers

deoxyribose is the 5carbon sugar found in DNA nucleotides

At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.

Answers

Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.

What is a Food web?

This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.

90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.

Read more about Food web here https://brainly.com/question/2179

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

why is it beneficial for scientists to understand how other organisms are able to edit which proteins are created

Answers

Answer:

Genome editing technologies enable scientists to make changes to DNA, leading to changes in physical traits, like eye color, and disease risk

Explanation:

What are the impacts of genomic era on microbial phylogeny systematics​

Answers

provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.

What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land

Answers

Answer:

I believe the answer is farming

Answer:

having a wildlife environment

Explanation:

I took the test and this was the correct answer so your welcome

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

Describe the different internal and external factors that affect human health.

Answers

Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.

Explanation:

Define nondisjunction. Is this a beneficial process? Explain.

Answers

Answer:

Nondisjunction occurs when chromosomes fail to segregate during meiosis; when this happens, gametes with an abnormal number of chromosomes are produced. The clinical significance is high: nondisjunction is the leading cause of pregnancy loss and birth defects

Explanation:

Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.

Answers

Answer:

C

Explanation:

It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer

Which type of rock would most likely be found near the landform shown in the picture? ​

Answers

Answer:

Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .

Explanation:

Have a Nice day!!  :D

Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (

Answers

How does a missense mutation affect the function of a protein?

A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

Why is over farming a threat to the health of humans?

A.
It decreases the use of fertilizer.

B.
It increases the production of food.

C.
It adds too many new nutrients to the soil.

D.
It removes too many nutrients from the soil.

Answers

Answer:

it removes too many nutrients from the soil.

Explanation:

Explanation:

it can increas the health risk

Other Questions
What parts are found in an electric generator? select 4 options. an armature a battery a permanent magnet an electromagnet brushes slip rings This table shows values that represent an exponential function x. What is the average rate of change for this function for the interval x=1 to x=3Table and Answer Choices on Screenshots If the mass of an object on Earth is 9 grams, what would the mass of the same object be onthe Moon? Lacie bought a $20 shirt that was marked down 30%. what did she pay after tax of 6% was added to the price of the shirt? pls help me. Will give 30 points and brainliest if you tell me how. I need 2 and 4. PLS HURRY "What is a real-life example of the Hero Journey?"Need this for my assignment and for the life of me can't find any examples What is the best way a person can take care of their mental health Which location represents a period on a periodic table?. What is the value of x? Enter your answer in the box. what is the correct answer to this? What is the best example of voter intimidation? -3.28+4.4-9.7 fdsafdsa I need help!!! Look at the attached file 4 2 5 03 2 8 72 1 8 ? PLEASE ANSWER QUESTION IN PICTURE Which of the following units are units of capacity? Select all that apply. please help me! I will make whoever answers brainiest! please help it's for a test!Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.Match each equation to the value of a that makes the equation true.103426(2a a + 1) = 244 + 3(a + 2) = 163a 2a 4 = 02a + 3(a + 1) = 8 Which headline describes an event that resulted from the terrorist attacks on september 11, 2001? Which of the following was most likely the consequence of the American reservation plan for Native Americans?- The Native Americans did not agree with what happened to them as a people, but continued to prosper.- The system weakened the tribes and is, in part, responsible for many of the problems that Native Americans continue to face today.- Native Americans never went to the reservations, instead fighting for and winning the right to stay in their homelands.- The Native Americans did quite well adjusting to American culture and became a highly respected part of society. is the soda ginger ale(canada dry) a weak acid or a strong acid? why