What does the line on a speed-time graph look like for an object with positive acceleration? 1. It slopes up.2. It slopes down.3. It is flat 4.It is vertical

Answers

Answer 1

Answer:

The principle is that the slope of the line on a velocity-time graph reveals useful information about the acceleration of the object. ... If the acceleration is positive, then the slope is positive (i.e., an upward sloping line). If the acceleration is negative, then the slope is negative (i.e., a downward sloping line).

Please mark brainliest as im on the way to leveling up ;p

Answer 2
Flat hope this helps!!

Related Questions

Which of the following is an example of a religious group, rather than an ethnic group, in the Middle East?
А
Arabs
B
Kurds
С
Persians
D
Sunnis

Answers

I feel like it is d

How was the Boston Tea Party different from an actual tea party?


a Many considered the Boston Tea Party an act of vandalism—dumping someone else’s tea in a harbor. An actual tea party is an event to sip and drink tea.

b The Boston Tea Party was an event to sip and drink tea. An actual tea party occurs on a British cricket field.

c The tax on tea was celebrated during the Boston Tea Party. An actual tea par ty is an event that serves small sandwiches.

d Many considered the Boston Tea Party Britain’s first tea-drinking party in the colonies. An actual tea party was one that started during the first Continental Congress.

Answers

Answer:

The answer is A.

Explanation:

I read a book about the Boston Tea Party. I hope this helps!

Answer: A.

Explanation: The Boston Tea Party was when colonists were upset with raised taxes so they dumped a shipment of tea into the river. All of the other answers suggest it was a legit tea party which it was not.

PLSSSSSSSSSSSSS HELPPPPP
Which geographic factors affect the domestic and foreign policies of the Middle East and often cause conflict?
A. Large bodies of water provide the main transportation routes.
B. Natural disasters continually devastate the region.
C. It is surrounded by volcanoes that require monitoring.
D. It is an arid (desert) region where water is scarce, and there is an abundance of oil.

Answers

I remember doing this in 7th grade, it’s A

The correct answer is option D. It is an arid (desert) region where water is scarce, and there is an abundance of oil which has an effect on the domestic and foreign policies of the Middle East.

What is the geographic factor affecting domestic and foreign policies of the Middle East?

Due to the abundance of oil in the region, the Middle East is usually at the center of geopolitical conflicts, both in the domestic and the foreign policy realm. Owing to their water scarcity, conflicts tend to escalate in the regions of the Middle East. Water and its scarcity contribute toward human development-oriented problems as well as the region's stability, as a whole. Domestic and foreign policy are deeply linked with the instability of the region and the many conflicts that take place in the Middle East. These conflicts take the shape of humanitarian crises and economic problems. With a rapidly depleting resource base and an increasingly deteriorating stability, the region is plagued by problems that have their root in water scarcity and the arid region of the Middle East. The abundance of oil in the region also becomes a problem spot as many countries across the world are keen on monopolizing this important and lucrative resource. This leads to conflicts of an international magnitude which escalates into prolonged periods of destabilization and war. These barriers also result in social and political issues that affect the domestic and foreign policies of the Middle East.

Hence, an arid region with scarce water and an abundance of oil is the central geographic factor affecting domestic and foreign policies in the region of the Middle East, causing conflicts thereby.

Learn more about the Middle East here: https://brainly.com/question/4364061

#SPJ2

Landforms contribute to the creation of ecosystems because:

Answers

Answer:

Landforms affect where people build houses and communities

Explanation:

Also, we’re animals can roam. Live. And where we live, humans need food and plants. If you were to live in somewhere cold, you most likely wouldn’t be able to grow plants for food, so no food for you or animals.

1. Thomas Jefferson served in the __________ Continental Congress.

Answers

Answer:

second Continental Congress

Answer:

Second Continental Congress

Explanation:

He was elected to the congress in 1775--later becoming president.

Read the information in the brainstorming table.
Beginning: First, I signed up to audition for a part in the school play. Middle: Then I recited my lines and sang a short solo for the chorus teacher. End: Blank.

Which piece of information best completes the table?


A. Every year, the students in our school put on a spring performance.

B. Finally, the chorus teacher announced there would be a school play.

C. Then I chose a song and prepared for my audition.

D. Finally, I was selected for a leading role in the play.

Answers

Answer:

Its D

Explanation:

I took the test on edge and also she had already sang and rehersed her lines she already tried out, They already annouced there would be a play and a is just pure wrong therefore it is D

Hope this helps! :)

Answer:

It is D

Explanation:

she had already sang and rehersed her lines she already tried out, They already annouced there would be a play

Explain why Upper Egypt is located in the South.​

-


​ Explain why Lower Egypt is located in the North.​


-

Answers

1.) The southern region was called upper Egypt because it was located upriver in relation to the flow of the Nile river. The Nile river sliced through the dessert of upper Egypt.
2.) The northern region was called lower Egypt because it was located downriver of the Nile.
The southern region was called Upper Egypt. It was so named because it was located upriver in relation to the Nile's flow. Lower Egypt, the northern region, was located downriver. The Nile sliced through the desert of Upper Egypt.


To the north was Lower Egypt, where the Nile stretched out with its several branches to form the Nile Delta. ... The terminology "Upper" and "Lower" derives from the flow of the Nile from the highlands of East Africa northwards to the Mediterranean Sea. The two kingdoms of Upper and Lower Egypt were united c.

Because of the Gault case, children and their families now have which of the following rights when charges are brought?

(i) Parents must be notified
(ii) The right to refuse to testify against oneself
(iii) The right to question witnesses
A.
i only
B.
ii only
C.
ii and iii only
D.
i, ii, and iii


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

D

Explanation:

When testifying you have the right to any one of these choices to benefit you in any way.

Which of the following individuals is considered to be the founder of Islam?
A
Jesus
B
Mohammad
С
Abraham
D
Siddhartha

Answers

B Mohammad hop this helps... :)

John and Patricia receive a summons to a delinquency case in which their daughter Keira is being charged with vandalism. Which of the following MUST have happened before John and Patricia received their summons? A. Keira was placed on probation B. a judge’s disposition C. the filing of a petition of complaint D. Keira was given a formal indictment by a grand jury Please select the best answer from the choices provided A B C D

Answers

Answer:

C

Explanation:

Because that is the only answer that makes sense to me. Probation is after that correct? First they would file the complaint for her to be brought in.

What can you infer about WHY the Ashanti might have been complicit in the slave trade?

Answers

They might have felt that it wasn’t right and unlawful

Answer:

The Asante (Ashanti people) Empire dominated the area known as the Gold Coast (Ghana). They traded in gold as well as slaves. They fought many wars to defend and expand their empire.

Explanation:

How did Tamar Morgan gain her freedom?

Your answer:

She purchased her freedom.


She escaped through the Underground Railroad.


Slaves were freed when Abraham Lincoln passed the 13th Amendment.

Answers

Answer:

She purchased her freedom.

Explanation:

Answer:

the first on I think???!!!!!

Please help me out!!


This is about hunger.


How can citizens get involved to help enact the policy?

Include your sources of information.

Thank you so much!

Answers

Answer: With tens of billions of dollars in anti-hunger funding at stake, government actions can dramatically increase or reduce

hunger and poverty. Public policy advocacy is often the single most effective step anyone can take to fight hunger. If you do seek to start a new program in an under-served area, you should be

aware that new soup kitchens and food pantries are often unable to obtain food from government programs and traditional

food banks until they have been in operation for significant periods of time, sometimes up to two to three years. If you are a

new soup kitchen or food pantry, food drives will most likely be your primary resource until you have been in operation for

long enough to qualify to purchase food from your local food bank.

Explanation: Hope this helps!

The person above me is correct

Which of the following makes a true statement?

The country with the highest amount of gold reserves is in Africa.
The country with the highest amount of gold reserves is in North America.
No country in North America has a significant amount of gold reserves.
No country in Africa has a significant amount of gold reserves.

Answers

I’m pretty sure it’s the third statement- North America has the highest amount of gold reserves. (U can just search which country has the highest amount of gold reserves).

Answer:

Algeria is Isia I know that one but not the others sorry

Explanation:

If something looks larger, smaller, or a different shape on a map than in reality, or appears to be out of place, it is probably a result of _____.
1,outdated rather than current information
2,distortion
3,poor mapmaking
4,scale

Answers

Answer:

scale correct me if I'm wrong pls

yea pre sure it’s option 4- scale

How did the Great Compromise compare to the Articles of Confederation?

A. The resolution, known as the Great Compromise gave more power to the federal government.
B. The resolution, known as the Great Compromise gave more power to the state governments. C. The resolution, known as the Great Compromise gave more power to the citizens of the United States.
D. The resolution, known as the Great Compromise gave more power to the King of Great Britain

Answers

I believe the answer is B because The Great Compromise was an agreement made to see how much power states would have under the Constitution.

The great compromise compared to the articles of confederation because the great compromise gave more power to the federal government.

The answer to this question is option A. The great compromise can be described as a double system of representation in the United States congress.

The states in the country were to receive their representatives based on the size of their states.

The articles of confederation on the other hand did not assign much powers to the federal government. The federal government of the United states had limits on what they could do following the articles.

Read more on https://brainly.com/question/19450412?referrer=searchResults

Please help me out!!
This is about hunger.


How can citizens get involved to help enact the policy?

Include your sources of information.

Thank you so much!

Answers

What policy are you talking about!

During the Boston Tea Party the colonists who dumped the tea disguised themselves as women.

True
False

Answers

Answer:

False - they disguised as indians

Explanation:

Answer:

True?

Explanation:

Explain two weaknesses of the Articles of Confederation and explain how these weaknesses led to the writing of a new federal Constitution...

Answers

Answer:

There was no judicial system, they couldn’t impose taxes

Explanation:

Lack of judicial system, they also couldn’t tax people, so little power

⭐️I’ll give braliest for the best answer! Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.

QUESTION {Consider the oral histories documented in this passage. How you would feel if this experience happened to you?

Answers

Answer:

this does not make sense because what passage?

Explanation:

but I'm still going to give an opinion on how I would feel if the world war happened to me.

Today there is going to be a war I'm not sure what to do but freak out and hide in the best spot I know I would be soooo scared and I would probably pray and cry during the whole thing and if I survive I would be so relieved and happy!!!

Answer:

Consider the oral histories documented in this passage. How you would feel if this experience happened to you?

I would most likely be in extreme pain if I was one of the Native Americans, and I would try to observe how the world is changing and try to either be an advocate for Native American rights. If that effort failed, I would try to immigrate out of the United States to find a safe haven until Native American rights are more developed.

Explanation:

This is my own answer and I received a 100% for it (make sure to include the question in your answer as well). Further proof that my answer is correct in the file attached.

Buying a car can be exciting and make it a lot easier to get around.A. True B. False

Answers

Answer:

A

Explanation:

Answer:

A. True

Explanation:

"Which theme is best supported in the text, "The Flight of Icarus?" Think about the steps from the previous lesson we practiced to write a theme statement. "
A: Learn to be happy with what you have.
B: Sometimes heroes fail
C: Being a good person is more important than beauty.
D: Self confidence can help you do great things.

THIS IS FROM THE FLIGHT OF ICARUS

Answers

The answer is A: learn to be happy with what you have. Icarus wanted to go higher and ended up falling because of that.

Who proposed the Anaconda Plan?
What was the Anaconda Plan?
Why were other Union generals opposed to the Anaconda Plan?
What were the two main objectives of the Anaconda Plan?
What was the purpose of the blockade?
Why did the North want to control the Mississippi River?
In your opinion, was the Anaconda Plan an effective military strategy?

Answers

Answer: Proposed by Union General-in-Chief Winfield Scott, the plan emphasized a Union blockade of the Southern ports and called for an advance down the Mississippi River to cut the South in two.

Explanation:

In the Vedic Age, what types of goods were traded most often? (4 points)

a goods that there is a shortage of

b goods that are expensive and rare

c goods that there is a surplus of

d goods that are cheap but rare

Answers

Explanation:

B goods that are expensive and rare

Answer:

C

Explanation:

I got it right on the test!

Exploration brought Europe and the Americas in contact with one another. This resulted in the movement of people, plants, animals, and germs—called the Columbian Exchange—that changed life on both continents. Was the Columbian Exchange good for the world? Write an essay for your teacher and peers in which you argue your view.

Answers

Answer:

One of the positive impacts the Columbian Exchange had on the world, was the massive exchange of crops. With the new crops brought into the Old World, the population increased due to the fact that the new crops were easy to store, grew fast, could withstand droughts well, gave a very high yield in calories.

Explanation:

The Colombian Exchange had both a negative and positive effect on the world. In your essay I would give two positives and two negatives. Hope this helps

HURRY plz answer the drops down

ill mark brainlest to first person to answer if correct

Answers

Answer:

First:

The Himalayas edge southwestern China, encompassing Tibet and Nepal and forming a natural barrier along the border of India.

Second:

The East China Sea extends to the east to the chain of the Ryukyu Islands; north to Kyushu, which is the southernmost of Japan's main islands; northwest to Cheju Island off South Korea; and hence west to China. ... The East China, South China, and Yellow seas.

Explanation:

I only remember those 2, sorry I couldn't help with all.

Which of these best explains a difference between a Representative Democracy and Parliamentary Democracy?

Answers

Answer: I definately think B.

Answer:

The answer is C.

Explanation:

I hope this helps!

The Edwards brothers are best known for creating the ______________________ .
A. Independent Republic of Fredonia
B. Declaration of Texas Independence
C. Texas Constitution of 1824
D. Republican Army of the North
It's not B or C btw

Answers

Answer:

A.

Explanation:

A. Because I got it right on my test

PLS HELP PLSSSS
The above monument was part of the religion of the __________________ and can still be found today in _________________________.

Which terms complete the sentence above?
A. South America...Mayans
B. Egyptians...Africa
C. Christians...Europe
D. Mayans...South America

Answers

B is the correct answer

Answer:

B.Egyptian...Africa

What is a boycott?


a when you harm someone else's property

b money paid for goods or merchandise

c a stamp on a newspaper

d when someone refuses to buy a product

Answers

Answer:

D. When someone refuses to buy a product

Explanation:

Answer:

D- When someone refuses to buy a product

Other Questions
A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above 5TH GRADE LEVEL QUESTION: look at photo and answer. A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT Please select the correct conjugation of the verb llamar ("to call") togo in the blank.Yoa sus nios por telfono.llamallamollamasllamamosFill in da blank 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 A 12 N net force is applied to an object as it moves a distance of 3.0 m: Use theWork-Kinetic Energy Theorem to determine the object's change in kinetic energy.Enter your answer in Joules. plz help i need help im failing Two moles of neon gas at 25oC and 2.0 atm is expanded to 3 times the original volume while the pressure is reduced to 1.0 atm. Find the end temperature.A. 447 CB. 174 CC. -66 CD. 38 CE. 150 C Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? 6th grade history i mark as brainliest A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? Why can humans float in space but not on Earth? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck