What happens if oranisms fall to adjust and respond to changes in their environment?

Answers

Answer 1

Answer:

they would probably go extinct

Explanation:

Answer 2
I’m assuming the whole environmental system would collapse animals would die off including humans

Related Questions

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

20 points and brainliest!
More and more often, farmers and food manufacturers are genetically modifying crops to improve flavor, reduce disease, and lower costs. Do you think genetically modifying food is a good idea? Use specific examples and reasons to support your opinion.

Answers

Explanation:

it is a good idea as it increase the life of certain food, also keeps bacteria away

Acrostic poem for nucleus

Answers

N naive
I independent
C curious
L lovable
E egotistical
U unique
S specialty


( I hope this helped ! )

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

1. What organisms save water by turning carbon dioxide into a special carbon compound before carrying out photosynthesis? O photosynthetic plants O Ce plants CAM plants O photosynthetic bacteria​

Answers

Answer:

I'm pretty sure its Ce plants

Explanation:

tell me if i'm wrong

C4 plants are the organisms which save water by turning carbon dioxide into a special carbon compound before carrying out photosynthesis. Thus, the correct option is B.

What are C4 plants?

A C4 plant is a plant which utilizes the C4 carbon fixation pathway for carbon dioxide fixation. C₄ carbon fixation pathway or the Hatch-slack pathway is one of the three known photosynthetic processes of carbon fixation in higher plants. C4 plants are characterized by the following features such as going through the C4 carbon fixation pathway. This pathway takes place when the carbon dioxide gas is first bound to the phosphoenolpyruvate molecule in the mesophyll cells. Then, the process proceeds to the Calvin Cycle in plants.

C4 plants have a special type of leaf anatomy which is known as Kranz anatomy. These plants can tolerate high temperatures, they show a response to high intensities of light, they also lack a process called photorespiration and have greater productivity of biomass than C3 plants and CAM plants.

Therefore, the correct option is B.

Learn more about C4 plants here:

https://brainly.com/question/15077689

#SPJ2

Your question is incomplete, most probably the complete question is:

What organisms save water by turning carbon dioxide into a special carbon compound before carrying out photosynthesis?

A. photosynthetic plants

B. C4 plants

C. CAM plants

D. photosynthetic bacteria​

Give SOME EXAMPLES OF NATURAL CYCLE CHECKPOINTS .

Answers

Answer:

For example, delays in mitosis are often ascribed to 'activation' of the mitotic checkpoint, a descriptor that fails to recognize that the checkpoint by definition is active as the cell starts mitosis. Conversely, the completion of mitosis in the presence of misaligned chromosomes is often automatically interpreted to indicate a defective checkpoint, even though in the absence of critical testing alternative interpretations are equally likely. In this article, we define the critical characteristics of checkpoints and illustrate how confusion generated by the inconsistent use of terminology may impede progress by fostering claims that mean very different things to different researchers. We will illustrate our points with examples from the checkpoint that controls progression through mitosis

Explanation:

Answer:

Below

Explanation:

G1 checkpoint, also known as the Start or restriction checkpoint or Major Checkpoint; the G2/M checkpoint; and the metaphase-to-anaphase transition, also known as the spindle checkpoint.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

A hiker has become overwhelmed with heat while walking in the Grand Canyon. The hiker's body goes into overdrive to keep cool in the heat. The hiker needs to hydrate his or her cells. What process is used to regulate homeostasis?

A. Balanced equilibrium
B. Passive transport
C. Cellular transport
D. Hydration

Answers

I think D is the answer

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

According to Chargaff's rule of base pairing, which of the following is true about DNA?
O A=G and C=T
O A=T and C=G
O A=T=G=C
O A=C and G=T

Answers

Answer:

a = t and c = g

Explanation:

just took the test, hope this helps <3

brainliest pls? :)

The Char gaff rule is all about the number of adenine is equal to the number of thymine and with that the number of cytosine is equal to the number of guanine. The correct answer is option B.

What are the types of bonds that are present in between these nitrogenous bases ?

The kind of bonds that are present in these  nitrogenous bases are hydrogen bonds. A binds with T with two hydrogen bonds and C binds with G through 3 hydrogen bonds.

It is all about that the number of purines is equal to the number of pyrimidines. The number of adenine molecule are present totally in equivalence to the number of thymine molecules.

The number of guanine molecules are present in the molecule of DNA are totally in numbers to the cytosine. In place of thymine uracil is present which is present in RNA.

Learn more about DNA at :

https://brainly.com/question/14315652

#SPJ2

in which direction do particles in a solution move during passive transport

Answers

During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.

What is the importance of the different types of transportation?

In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.

Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.

Learn more about the different types of transportation here.

https://brainly.com/question/29764225

#SPJ6

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

What is the series of processes in which a plant converts sunlight into a useful simple sugar called?

division

choloplasts

photosynthesis

mitosis

Answers

Answer: Photosynthesis

Explanation: I had this question to and it should be correct. I’m sorry if not.

HELP ME PLSSS someone

Answers

Answer: B

Explanation: The amount of salt in the inner circle is equal to the amount of salt in the outer circle.

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

can u answer that question

Answers

Answer:

The synthesis of new proteins

If you have a viral infection, why should you cover your mouth when you sneeze? * To prevent other people from breathing in the viruses you expel To prevent viruses from infecting cells in your nose and mouth To keep as many viruses as possible in your own body To get all of the cold viruses out of your body and onto your skin.

Answers

Answer:

To prevent other people from breathing in the viruses you expel

Explanation:

CORRECT

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?

Answers

it’s b, meiosis is mixing both parent cells genetic information therefore their offspring have a better chance at sieving

Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.

The correct answer is:

Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.

The significance of meiosis can be explained as:

Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.

The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.

Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.

Thus, meiosis is an important step in the genetic variation and survival of the organism.

Therefore, option B is correct.

To know more about meiosis, refer to the following link:

https://brainly.com/question/11622266

someone pleaseee help me with this !!

Answers

lizards and snakes!

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
a) A – T – C – C – T – A – G – A – A – G – G – T __________
b) C – G – T – T – G – C – A – G – A – A – C – T __________
c) T – A – C – G – G – A – T – C – G – T – C – A __________

Answers

a) TAGGATCTTCCA
b)GCAACGTCTTGA
c)ATGCCTAGCAGT

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

Other Questions
which following equal to forty and two hundred seventy four thousandsths?A. 40.274B.40.074C.40.274D.40.0274 Jacob is 4 feet 5 inches tall. How tall is Jacob in inches?O 48 inches09 inches020 inches0 53 inches Choose the word or phrase that best completes each sentence.Ghana gained most of its wealth because it controlled the__.Ghana collected __to add to the empires wealth.Ghana was known as the land of gold, and it traded gold for __ Once a body is in top physical condition, the 24-hour recovery period after low-intensity exercise can be safely skipped.Please select the best answer from the choices provided.TF Claire's mother consumed alcohol while pregnant with her. Now, Claire struggles with hyperactivity and language outbursts. How would you categorize her struggles? A. physical deformities B. learning difficulties C. behavioral difficulties D. mental difficulties 5What is the missing value in the following arithmetic sequence?439.2215.6n3.82an7.17.2747.5 Wie funktionieren Hintern? in which of the following ways were the political policies of the Inca Empire similar to the soul dance policies in India as described in the passage?a. the Inca have a public education system under the oversight of a government Authority b. the Inca used a system of taxes to amass financial resources and enforce policies c. the Inca use gifts of land to ensure cooperation from officials to enforce policiesd. the Inca had a centralized government that built and maintained roads Bridges and other Public Works Which of the following would Christians agree with?1) the 10 Commandments are important2) after a person dies their spirit is reborn on the earth in another form3) many gods rule the earthb. 4) Jesus was a wise teacher, but not a god Question 6 of 10What is the role of the commutator in a DC generator?O A. It causes the magnetic fields of the permanent magnets toreverse.B. It causes the electric current to constantly reverse its direction.C. It keeps the electric current flowing in one direction.D. It keeps the magnetic fields of the permanent magnet steady.SUBMI find the quotient 8 divided by 1/7. Please answer correctly !!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!! help plz it would mean a lot How is a revolution similar or different than a civil war? Which pair of triangles MUST be similar? A. Triangle 5 has a 25 degree angle and a 75 degree angle. Triangle 6 has a 25 degree angle and a 70 degree angle. B. Triangles 1 and 2 each have a 40 degree angle.C. Triangle 7 has a 40 degree angle and a 35 degree angle. Triangle 8 has a 40 degree angle and a 105 degree angle. D.Triangles 3 and 4 are both scalene. Each have a 65 degree angle. Solve for x. Round to the nearest tenth. True or False: Fibers are easily matched/identified in a criminalinvestigation and always aid in catching criminals? Launch Problem 1Nikki spent 2/5 of her birthday money on new shoes and 1/4 of herbirthday money on a new headband1. What is the LEAST common multiple denominator?Question 21 pts Maine has a cold climate in the winter. Which statement about the probability of temperatures falling below 32F in Maine during the month of January is most likely true? Options: The probability is 100 | The probability is closer to 1 than to 0. The probability cannot be determined before Febuary The probability could be -1. Express the following situation a a funstion: the population of a school is 800 and is decreasing at a rate of 2% per year