What if a person SHOULD have inherited the Normal Coding DNA from
their parents leading to the "trait" described by the amino acid sequence in
the protein BUT... something happened leading to the mutation shown in
the Mutant Coding DNA [Mutations highlighted Green] 1) Transcribe and
translate the Normal DNA and tell me which trait they SHOULD have
inherited 2) Transcribe and translate the Mutant DNA and tell me which
trait they ACTUALLY inherited. 3) Would this be an example of a "silent
mutation"? Explain why or why not.
You should work this out on scratch paper. Be VERY careful when copying down
the DNA (and/or writing out your mRNA sequences) to make sure you don't change
the sequence. Your answer should be a string of letters representing the amino
acids in the protein (do NOT type the mRNA sequence). The amino acid sequence
will spell real WORDS if done correctly.
Normal Coding DNA AATATGCCCAGGGAAACGACATATTTTGCGTGCGAATGA
Mutant Coding DNA AATATGAGTATACTCCTGTATTTTGCGTGCGAATGA

What If A Person SHOULD Have Inherited The Normal Coding DNA Fromtheir Parents Leading To The "trait"

Answers

Answer 1

The genetic mutation was a silent mutation in the coding region of the DNA that caused a change in the DNA of the organism. Thus, the correct option is A.

Silent mutations are the change in a single DNA nucleotide within a protein-coding portion (exon) of a gene. This mutation does not affect the sequence of the amino acids that makes up the proteins. Mutations are the changes in the nucleotides of nucleic acids which occur due to various mutagens.

A gene mutation in the mRNA sequence but does not affect the amino acid sequence and function of the protein is called silent mutation. The sequence of the codon for a particular amino acid does not always lead to change in the sequence of amino acids in a protein.

Therefore, the correct option is A.

Learn more about Mutation here:

brainly.com/question/13923224

#SPJ1


Related Questions

what is the role of tendons in our musculoskeletal morphology?

Answers

Tendons are fibrous connective tissues that attach muscles to bones and transmit forces generated by the muscles to the bones.

Tendons are composed of collagen fibers that are arranged in parallel, making them strong and durable. In our musculoskeletal morphology, tendons play a crucial role in providing stability, control, and range of motion.

They work together with muscles and bones to form functional units called musculoskeletal chains, which allow for efficient and coordinated movement. Tendons also act as energy storage units, absorbing and releasing elastic energy during movement.

This helps to reduce the energy demand on the muscles and allows for more efficient movement. Overall, tendons are essential components of our musculoskeletal system, providing the necessary strength, stability, and energy transfer needed for movement and physical activity.

Learn more about Tendons:

https://brainly.com/question/31716179

https://brainly.com/question/3205735

among insulin, epinephrine and glucagon, which would increase glycogenesis (glycogen synthesis) and decrease glycogenolysis (glycogen breakdown) in liver?

Answers

Out of the three options provided, insulin is the hormone that would increase glycogenesis and decrease glycogenolysis in the liver.

Insulin promotes the uptake of glucose into liver cells and stimulates the enzymes that convert glucose into glycogen for storage. Additionally, insulin inhibits the breakdown of glycogen into glucose, which is known as glycogenolysis. On the other hand, epinephrine and glucagon both stimulate glycogenolysis in the liver to release glucose into the bloodstream for energy during times of stress or fasting. Glycogenolysis is the biochemical pathway in which glycogen breaks down into glucose-1-phosphate and glucose. The reaction takes place in the hepatocytes and the myocytes. The process is under the regulation of two key enzymes: phosphorylase kinase and glycogen phosphorylase.

Learn more about glycogenolysis here:

https://brainly.com/question/30636759

#SPJ11

.What the cilia and flagella visible under a light microscope?

Answers

Cilia and flagella are microstructures that can be visible under a light microscope. These structures are found in various types of cells and serve important functions related to movement and sensory perception.

Cilia are short, hair-like projections that extend from the surface of certain cells.

They are usually present in large numbers and can be observed in tissues like the respiratory tract, where they help in moving mucus and foreign particles away from the lungs.

Cilia also play a role in facilitating the movement of fluid along the surfaces of cells in organs like the reproductive system.

Flagella, on the other hand, are long, whip-like appendages that are typically found as a single or a few projections on a cell. They are responsible for cell movement.

A well-known example is the tail-like flagellum of sperm cells, which propels them towards the egg during fertilization.

Under a light microscope, cilia and flagella appear as thin, elongated structures protruding from the cell surface. Their movement can be observed when they beat or undulate rhythmically.

To enhance visibility, specialized staining techniques or high-resolution microscopy methods may be employed.

Overall, the observation of cilia and flagella under a light microscope provides valuable insights into cellular functions related to motility and sensory reception.

To know more about microstructures refer here

brainly.com/question/29454385#

#SPJ11

What process typically regulates the enzymes involved in metabolic reactions?
- feedback inhibition
- ATP blockage
- temperature levels
- entropy capture
- substrate inhibition

Answers

The process that typically regulates the enzymes involved in metabolic reactions is feedback inhibition.

This mechanism is a type of negative feedback where the end product of a metabolic pathway acts as an inhibitor of an enzyme earlier in the pathway. By inhibiting the activity of the enzyme, the feedback inhibition ensures that the metabolic pathway does not produce more of the end product than is necessary for the cell's needs. This helps to conserve energy and resources.
Other mechanisms that can regulate enzymes involved in metabolic reactions include ATP blockage, substrate inhibition, and temperature levels. ATP blockage occurs when high levels of ATP inhibit the activity of enzymes that produce ATP. Substrate inhibition occurs when high levels of substrate inhibit the activity of enzymes that use the substrate. Temperature levels can also affect enzyme activity, as enzymes typically have an optimal temperature range for activity.
Entropy capture is not a process that regulates enzymes involved in metabolic reactions. Entropy capture is a theoretical concept related to the laws of thermodynamics and the capture of energy from non-equilibrium systems.

Learn more about enzymes

https://brainly.com/question/31130362

#SPJ11

how are ferns better adapted to terrestrial life than mosses

Answers

Ferns are better adapted to terrestrial life than mosses due to their well-developed vascular system, roots, efficient leaf structure for photosynthesis, and specialized spore production for effective dispersal and viability.

Ferns are better adapted to terrestrial life than mosses for several reasons:

1. Vascular system: Ferns have a well-developed vascular system with xylem and phloem, which allows them to transport water, minerals, and nutrients efficiently throughout the plant. This helps them grow taller and thrive in a variety of environments. Mosses, on the other hand, lack a vascular system, limiting their size and restricting them to moist environments.

2. Roots: Ferns have true roots that anchor them to the ground and absorb water and nutrients from the soil. Mosses lack true roots and instead have rhizoids, which are less efficient at absorbing nutrients.

3. Leaves: Ferns have true leaves, called fronds, that can photosynthesize more effectively, allowing them to harness more energy from the sun. Mosses have simple, small leaves that are less efficient at photosynthesis.

4. Reproduction: Ferns produce spores in specialized structures called sporangia, which are protected by a layer of cells. This helps their spores stay viable for longer periods and disperse more effectively. Mosses release their spores directly into the environment, making them more vulnerable to drying out or not reaching a suitable habitat.

These adaptations help ferns survive and thrive in terrestrial environments more successfully than mosses.

To learn more about ferns visit : https://brainly.com/question/382714

#SPJ11

the most important chemical group that determines how tightly histones bind dna is

Answers

The most important chemical group that determines how tightly histones bind DNA is the "acetyl group."

When acetyl groups are added or removed from histones, it influences the binding strength and accessibility of the DNA for gene expression.

The most important chemical group that determines how tightly histones bind DNA is the positively charged amino acid residues, such as lysine and arginine, that are present on the surface of the histone proteins. These residues interact with the negatively charged phosphate groups on the DNA backbone, forming electrostatic interactions that contribute to the stability of the nucleosome structure. Additionally, other chemical modifications to the histone proteins, such as acetylation or methylation, can alter the charge and chemical properties of the amino acid residues and affect the strength of the histone-DNA interaction.

To know more about Histones, visit:

https://brainly.in/question/6733583

#SPJ11

The most important chemical group that determines how tightly histones bind DNA is the degree of acetylation, which is influenced by the degree of phosphorylation of the N-terminal histone tails. Histones are highly alkaline proteins that are important components of chromatin.

The N-terminal amino acid tails of histones, which protrude from the histone core and are relatively accessible to the solvent, are heavily modified by posttranslational modifications, including acetylation, phosphorylation, methylation, and ubiquitination. Acetylation of histone lysine residues has been linked to increased chromatin accessibility, while deacetylation has been linked to condensed chromatin. The degree of acetylation is influenced by the degree of phosphorylation of the N-terminal histone tails, which affects the charge of the histones and influences their interaction with DNA.

The degree of acetylation is the most critical chemical group that determines how tightly histones bind DNA. Posttranslational modifications, such as acetylation, phosphorylation, methylation, and ubiquitination, heavily modify the N-terminal amino acid tails of histones.

The degree of acetylation has been linked to increased chromatin accessibility, while deacetylation has been linked to condensed chromatin. The degree of phosphorylation of the N-terminal histone tails affects the charge of the histones, which affects their interaction with DNA.

To know more about acetylation visit:

brainly.com/question/30938724

#SPJ11

the adrenal cortex is responsible for producing which substances?

Answers

The adrenal cortex is responsible for producing several substances, including steroid hormones known as corticosteroids. The two main types of corticosteroids produced by the adrenal cortex are glucocorticoids and mineralocorticoids.

The adrenal cortex is responsible for producing several substances, including:

1.Cortisol: This hormone is involved in regulating metabolism, immune response, and stress response. It helps the body maintain blood pressure and blood sugar levels, suppresses inflammation, and influences the breakdown of proteins, carbohydrates, and fats.

2.Aldosterone: This hormone regulates electrolyte balance, particularly sodium and potassium, in the body. It helps maintain blood pressure and fluid balance by increasing the reabsorption of sodium and the excretion of potassium in the kidneys.

3.Androgens: The adrenal cortex also produces small amounts of male sex hormones called androgens, including dehydroepiandrosterone (DHEA) and testosterone. These hormones play a role in the development and maintenance of secondary sexual characteristics in both males and females.

It's worth noting that the adrenal cortex is part of the adrenal glands, which are located on top of the kidneys. The adrenal glands consist of the outer adrenal cortex and the inner adrenal medulla. While the adrenal cortex produces the substances mentioned above, the adrenal medulla is responsible for producing and releasing adrenaline (epinephrine) and noradrenaline (norepinephrine), which are involved in the body's fight-or-flight response.

In summary, the adrenal cortex is responsible for producing corticosteroids, specifically glucocorticoids and mineralocorticoids.

To know more about adrenal visit: https://brainly.com/question/30245239

#SPJ11

Science Instructor Statement: In this 5th unit/module we are observing how our species along with many other species interact among each other in their surroundings or the environment. One major problem that is drastically impacting all known species on this planet Earth is our species population growth.

1.) How is climate change impacting our environment and other species ecology?

2.) How is human population growth impacting other species and their environmental surroundings?

Answers

Climate change is impacting our environment and other species' ecology by altering temperature patterns, causing sea-level rise, and disrupting ecosystems.

This leads to habitat loss, shifts in species' distribution, changes in phenology, and increased extinction risk, ultimately impacting biodiversity and ecological balance.

Human population growth is impacting other species and their environmental surroundings through habitat destruction, resource depletion, pollution, and fragmentation. These activities result in loss of biodiversity, disruption of food chains, and destruction of ecosystems, threatening the survival and well-being of numerous species and compromising ecological integrity.

Learn more about Climate change, here:

https://brainly.com/question/31604908

#SPJ1

Scientists today can use many investigative methods to study evolution. Which method was developed after Darwin’s time?
DNA comparisons
observations
comparison of fossils
experimentation

Answers

Answer:

DNA Comparisons.

Explanation:

hope this helps!

Answer: DNA Comparisons

Explanation: edge 2023

select the most accurate statement regarding measurements of urinary hormone: a) Requires blood and urine sampling
b) Drugs will not alter testing results
c) Provide a better measure of hormone levels during a designated period
d) Discarded samples will not alter results

Answers

The most accurate statement regarding measurements of urinary hormone is: Provide a better measure of hormone levels during a designated period. Option c is correct.

Measurements of urinary hormones are often used to monitor hormone levels over a specific period of time, as urine samples provide a more accurate measure of the hormones that have been metabolized and eliminated from the body. Blood samples can be affected by factors such as hormone-binding proteins and fluctuations in hormone levels throughout the day, while urinary hormone measurements provide a more consistent and reliable measure of hormone levels over time. However, it is important to note that certain drugs and discarded samples can potentially alter the results of urinary hormone testing.

It should be noted that antidiuretic hormone (ADH) is a chemical that is produced in the brain which them causes the kidneys to release less water, as well as decreasing the amount of urine produced.

In this case, a high ADH level causes the body to produce less urine while a low level results in greater urine production.

Therefore, the statement that is accurate about antidiuretic hormone is that ADH is released by the posterior pituitary gland

Learn more about hormone  here

https://brainly.com/question/28072923

#SPJ11

what happens to the unfertilized egg from day 1-4

Answers

During the menstrual cycle, an unfertilized egg is released from the ovary on day 14 and travels down the fallopian tube towards the uterus.

If the egg is not fertilized within 24 hours, it begins to break down and is reabsorbed by the body. This process typically occurs within the first 4 days after ovulation. The shedding of the unfertilized egg and the lining of the uterus during menstruation marks the start of a new menstrual cycle.

Unfertilized eggs in the ovary prepare for growth and maturation within the follicle between days 5 and 13 of a woman's menstrual cycle, while the endometrium, the uterine lining, gradually grows.

A woman's menstrual cycle typically lasts 28 to 30 days, during which time both physiological and hormonal changes related to the reproductive process take place.

The endometrium, which had previously formed to aid in the implantation of a potential pregnancy, sheds as a result of menstruation. The hallmark of this phase, which typically lasts five days, is vaginal bleeding.

A woman's reproductive system changes from the fifth to the thirteenth day in anticipation of potential fertilisation and pregnancy.

Learn more about woman's menstrual cycle  here

https://brainly.com/question/14967381

#SPJ11

Which hormone has NO role in potassium ion regulation?
A) insulin
B) parathyroid hormone (PTH)
C) epinephrine
D) aldosterone

Answers

Answer:

B. Parathyroid hormone (PTH)

Explanation:

hope this helps!

The hormone that has NO role in potassium ion regulation is insulin. The answer is: A)

Insulin primarily plays a crucial role in regulating glucose metabolism, promoting the uptake of glucose by cells and facilitating its storage as glycogen.

On the other hand, the other three hormones listed—parathyroid hormone (PTH), epinephrine, and aldosterone—do have roles in potassium ion regulation:

- Parathyroid hormone (PTH) helps regulate calcium and phosphorus levels in the body, but it also indirectly affects potassium balance by influencing the reabsorption and excretion of potassium in the kidneys.

- Epinephrine, also known as adrenaline, is involved in the fight-or-flight response and affects various physiological processes, including the redistribution of potassium ions in the body.

- Aldosterone, a hormone produced by the adrenal glands, plays a key role in regulating sodium and potassium balance by promoting sodium reabsorption and potassium excretion in the kidneys.

Therefore, the correct option is A).

To know more about Insulin, refer here:
https://brainly.com/question/1299358
#SPJ11

Which term refers to biological processes that keep body variables within a fixed range?

Answers

The term that refers to biological processes that keep body variables within a fixed range is homeostasis.


Homeostasis is a fundamental concept in biology that describes the ability of an organism or a system to maintain a stable internal environment despite changes in the external environment. This is achieved through a variety of mechanisms, including feedback loops that regulate physiological variables such as body temperature, blood pressure, pH, and glucose levels.

Homeostasis is essential for the proper functioning of all living organisms, as it allows them to adapt to changing conditions while maintaining a stable internal state. Disruptions in homeostasis can lead to a range of health problems and diseases.


If you need to learn more about biological processes click here:

https://brainly.com/question/29770775

#SPJ11

Which of the following are hormonal-related symptoms of menopause?
a. Poor respiration and hot flashes
b. Hot flashes and vaginal dryness
c. Vaginal dryness and joint stiffness
d. Joint stiffness and poor respiration

Answers

Hot flashes and vaginal dryness are hormonal-related symptoms of menopause.

Correct option is B. Hot flashes and vaginal dryness.

Hot flashes are one of the most common symptoms of menopause and can occur suddenly and without warning. They can cause a feeling of intense heat, sweating, and rapid heartbeat. Vaginal dryness is another common symptom that can cause discomfort and pain during intercourse.

Joint stiffness can cause pain and discomfort in joints, especially during periods of inactivity. Poor respiration can cause shortness of breath and difficulty breathing, which can be especially concerning for those with existing respiratory conditions.

Correct option is B. Hot flashes and vaginal dryness.

know more about menopause here

https://brainly.com/question/31935107#

#SPJ11

when plasma glucose concentration exceeds the renal plasma threshold,

Answers

When the concentration of glucose in the blood (plasma glucose concentration) exceeds a certain threshold, known as the renal plasma threshold (RPT), the kidneys begin to filter and excrete excess glucose into the urine.

The RPT is typically around 180 mg/dL, but it can vary depending on factors such as age, gender, and overall health status.

This process of filtering and excreting excess glucose is known as glucosuria, and it is a hallmark of diabetes mellitus, a condition characterized by high blood glucose levels.

In diabetes, the body either does not produce enough insulin or is unable to effectively use the insulin it produces, which leads to high blood glucose levels and glucosuria.

Glucosuria can lead to frequent urination, excessive thirst, and dehydration if left untreated. It can also increase the risk of urinary tract infections and kidney damage.

Therefore, it is important for people with diabetes to monitor their blood glucose levels and work with their healthcare team to manage their condition effectively.

To know more about renal plasma threshold (RPT) refer here:

https://brainly.com/question/29765719#

#SPJ11

Photosynthetic cells produce sugar and , which are then transported via the Multiple Choice organic molecules xylem CO2 stomata Co2 phloem organic molecules; phloem minerels; xylem

Answers

Photosynthetic cells produce sugar and organic molecules, which are then transported via the phloem. Photosynthetic cells contain chloroplasts that help in the production of organic molecules, glucose, and oxygen by photosynthesis.

These organic molecules are then transported via the phloem to different parts of the plant. Phloem is the vascular tissue in charge of transporting dissolved organic molecules, primarily sugar, from the leaves to the other parts of the plant through translocation. The process of translocation involves the movement of the sugar from the photosynthetic source or the place where sugar is produced, to the sink, or the place where sugar is utilized or stored.

Apart from the phloem, the xylem is another vascular tissue that plays a vital role in the transport of water and minerals to different parts of the plant. Stomata are small pores on the leaves through which carbon dioxide enters the plant, and oxygen is released. Therefore, stomata are not involved in the transportation of sugar and organic molecules. Similarly, CO2 is absorbed through stomata and not involved in sugar transport.

To know more about Photosynthetic cells click here:

https://brainly.com/question/30722182

#SPJ11

the organic chem lab survival manual: a student's guide to techniques

Answers

The Organic Chem Lab Survival Manual: A Student's Guide to Techniques is a book that provides comprehensive guidance and tips for students taking organic chemistry laboratory courses. This book covers a wide range of topics including laboratory safety, equipment usage, experimental procedures, and data analysis. The manual also includes detailed instructions on various laboratory techniques such as distillation, extraction, and chromatography.

The Organic Chem Lab Survival Manual is written in a user-friendly and easy-to-understand manner, with step-by-step instructions, diagrams, and illustrations to aid comprehension. The book also provides useful information on how to keep a laboratory notebook, write lab reports, and troubleshoot common experimental problems.

This book is an excellent resource for students who are new to organic chemistry laboratory work or who want to improve their skills and techniques. It offers a long answer to common questions and provides a valuable reference for future experiments. Overall, The Organic Chem Lab Survival Manual is an essential tool for any student who wants to excel in organic chemistry lab courses.

To know more about Organic Chem Lab, refer

https://brainly.com/question/30874544

#SPJ11

True or False Sea turtles laying more eggs than can possibly survive is an example of competition as a factor in natural selection.

Answers

Answer:

true

Explanation:

name the general sensory receptors that belong to each structural class
a) free nerve endings
b) encapsulated nerve endings

Answers

The general sensory receptors that belong to each structural class:

a) free nerve endings - non-encapsulated or unencapsulated nerve endings.

b) encapsulated nerve endings -  encapsulated nerve endings.

a) Free nerve endings are general sensory receptors that belong to the structural class of non-encapsulated or unencapsulated nerve endings. They are simple nerve endings that consist of bare nerve fibers that are distributed throughout various tissues and organs, including the skin, mucous membranes, and connective tissues.

b) Encapsulated nerve endings are general sensory receptors that belong to the structural class of encapsulated nerve endings. These receptors are surrounded by specialized structures or capsules that enhance their sensitivity and response to specific stimuli.

Examples of encapsulated nerve endings include Meissner's corpuscles, Pacinian corpuscles, Ruffini endings, and Krause end bulbs. Each of these encapsulated receptors has unique characteristics and is sensitive to specific types of stimuli, such as touch, pressure, vibration, or temperature.

Learn more about sensory receptors here:

https://brainly.com/question/30227541

#SPJ11

Which of the following must be used to perform a CAMP test? (Check all that apply) 5 Check All That Apply "Unknown" beta hemolytic streptoccus to be tested Blood agar plate Bile esculin slant Bacitracin disk Staphylococcus aureus culture Streptococcus pneumoniae culture

Answers

Answer:

Explanation:

Which of the following body sites normally have large numbers of resident microbiota?

- Liver

- Large intestine

- Blood

- Throat

- Brain

- Nose

- Skin

- Vagina

- Large intestine

- Throat

- Nose

- Skin

- Vagina

A microorganism that is most often harmless but may occasionally cause infection and disease if the host defenses are compromised is referred to as an ________________ pathogen.

Opportunistic

Which of the following are genera of gram-positive cocci frequently found as resident microbiota in humans?

- Enterococcus

- Streptococcus

- Staphylococcus

- Neisseria

- Escherichia

- Enterococcus

- Streptococcus

- Staphylococcus

Which of the following infections are frequently caused by Staphylococcus species as well as Streptococcus species?

- Pharyngitis

- Urinary tract infection

- Pneumonia

- Diarrhea

- Abscess

- Endocarditis

- Urinary tract infection

- Pneumonia

- Abscess

- Endocarditis

Which of the three tests conducted in this identification process did not require the use of an incubator?

- Coagulase test

- Catalase test

- Novobiocin sensitivity test

- Mannitol salt agar plate

Catalase test

Based on this flowchart, what is true about Staphylococcus saprophyticus?

- Possesses catalase enzyme

- Does not possess coagulase enzyme

- May not ferment mannitol

What would this organism look like under the microscope?

Purple spherical bacteria in clusters

Based on the result recorded for the mannitol salt agar plate, what color was the medium after incubation?

Pink

What test eliminated streptococci as potential agents in this case?

Catalase test

The following lab activities are frequently done in the medical microbiology lab. Match each of the lab activities with their purpose.

- Culture - Uses several different types of media to grow bacteria from patient specimens

- Identification - Uses a variety of tests and media to determine the genus and species of a bacterial isolate

- Sensitivity - Tests a microorganism with a battery of different antibiotics to determine which antibiotics are most likely to control or eliminate the infection

00:03

01:11

FILL IN THE BLANK. ______ provide surface area for the action of enzymes and to provide storage space for these important enzymes.

Answers

Organelles provide surface area for the action of enzymes and to provide storage space for these important enzymes.

The answer is "Organelles."

Organelles such as the endoplasmic reticulum and the Golgi apparatus provide surface area for the action of enzymes and to provide storage space for these important enzymes. Enzymes are proteins that catalyze chemical reactions in living organisms, and they require a specific environment to function properly. The surfaces of organelles provide this environment, allowing enzymes to perform their necessary functions. Additionally, organelles serve as storage spaces for enzymes, allowing cells to quickly access the necessary enzymes when needed. Overall, organelles play a crucial role in ensuring the efficient functioning of enzymes within cells.

Learn more about enzymes here:

https://brainly.com/question/31385011

#SPJ11

Argument: if humans are echinoderms, then humans are invertebrates. it is false that humans are echinoderms. therefore, it is false that humans are invertebrates. form of argument:_____

Answers

The argument presented is a categorical syllogism that relies on the accuracy of its premises to reach a conclusion. However, since the second premise negates the first, the argument cannot be considered valid.

The form of argument presented here is a syllogism, specifically a categorical syllogism. It is composed of two premises and a conclusion. The first premise establishes a relationship between humans and echinoderms, suggesting that if humans are classified as echinoderms, then they must be invertebrates. The second premise, however, negates the first premise by stating that it is false that humans are echinoderms. Therefore, the conclusion drawn from these premises is that it is also false that humans are invertebrates.

It is important to note that this argument relies on the accuracy of its premises. If the first premise is true, and humans are indeed echinoderms, then the conclusion that humans are invertebrates would logically follow. However, since the second premise negates this assumption, the argument cannot be valid. In reality, humans are not echinoderms but are instead classified as mammals, meaning they are vertebrates.

Learn more about categorical syllogism here :-

https://brainly.com/question/21635821

#SPJ11

A cell placed in pure honey will die due to the environemnt. O Ectotonic O Hypertonic O Isotinic O Hypotonic

Answers

A cell placed in pure honey will die due to the hypertonic environment.

Honey is a highly concentrated solution of sugars, making it hypertonic compared to the cellular environment. When a cell is immersed in a hypertonic solution, water will move out of the cell through osmosis, resulting in cell shrinkage and dehydration. In the case of pure honey, the high concentration of solutes outside the cell will draw water out of the cell at an accelerated rate, leading to severe dehydration and eventually cell death. Therefore, the hypertonic nature of honey causes cells to lose water, resulting in their demise.

learn more about hypertonic here :

https://brainly.com/question/8984839

#SPJ11

You have discovered a mutant cell line that has defective endosomes that you suspect are 10% larger in size. The best way to determine if this is true would be to perform A. Scanning electron microscopy B. Transmission electron microscopy C. Laser scanning confocal microscopy D. X-ray crystallography E. NMR spectroscopy

Answers

TEM would be the best way to determine if the mutant cell line has defective endosomes that are 10% larger in size.

The best way to determine if the mutant cell line has defective endosomes that are 10% larger in size would be to perform transmission electron microscopy (TEM). This technique allows for high resolution imaging of cellular structures, including endosomes. TEM uses a beam of electrons to pass through thin sections of the sample, which are then captured on a photographic plate or digital detector. This results in a detailed image of the internal structures of the cell, including endosomes.

Scanning electron microscopy (SEM) could also provide information on the size of the endosomes, but it primarily provides surface information and may not be as useful for studying internal cellular structures. Laser scanning confocal microscopy (LSCM) is a useful tool for visualizing fluorescently labeled structures within cells, but may not be as useful for determining the size of endosomes. X-ray crystallography and NMR spectroscopy are techniques used primarily for studying the structure of proteins and other macromolecules and would not be directly useful for determining the size of endosomes.

Learn more about endosomes here:-

https://brainly.com/question/31608740

#SPJ11

Which one of the following hominins did not have a double arched brow ridge?
A.Homo Heidelbergensis
B.Homo erectus
C. Neandertals
D.No answer text provided

Answers

D. No answer

However, to provide a complete answer, none of the hominins mentioned in the question had a single clear answer for this question.

While Homo erectus is often described as having a double-arched brow ridge, some specimens show variations in the shape and prominence of this feature.

Similarly, while Neanderthals are often characterized by their prominent brow ridges, not all specimens show a clear double-arched structure.

Likewise, Homo heidelbergensis exhibits variation in brow ridge morphology, with some specimens showing a more pronounced double arch and others exhibiting a more sloping forehead.

Overall, brow ridge morphology can vary within and between hominin species, and should be considered as one of several diagnostic features used to identify fossil specimens.

To know more about hominins  refer here

brainly.com/question/31237093#

#SPJ11

The diversity of species in a community refers to the _____.ability to resist changenumber of individual organismsnumber of different speciesinteractions of different species

Answers

The diversity of species in a community refers to the number of different species present.

This can have important implications for the interactions of different species within the community, as well as for the community's ability to resist change over time. In essence, greater species diversity tends to promote greater stability and resilience within ecological communities.
                                                 The diversity of species in a community refers to the number of different species. This term is important in understanding the complexity and overall health of an ecosystem. A diverse community typically indicates a more stable and resilient ecosystem, as a variety of species can contribute to various ecological processes and functions.

                                This can have important implications for the interactions of different species within the community, as well as for the community's ability to resist change over time.

Learn more about diversity of species

brainly.com/question/14426872

#SPJ11

Which of the following may cause insulin shock to develop? a. recurrent vomiting b. missing an insulin dose c. eating excessively large meals

Answers

Insulin shock, also known as hypoglycemia, may develop due to several factors. In this case, the most likely cause is option B: missing an insulin dose.

When a person with diabetes misses their insulin dose, it can result in low blood sugar levels, leading to insulin shock.

The body releases insulin to take glucose from the blood into the cells when blood glucose levels are high. When the body consumes a meal high in carbohydrates, the blood is pumped through the colon and into the cells, where it must be delivered. Insulin is the only hormone that can do this. These prevent diabetes by keeping blood glucose levels within a normal range. If they don't, diabetes develops. On the other side, glucagon signifies a low amount of blood glucose in control.

The liver produces a chemical called glucose, which is crucial for metabolism because it controls blood glucose levels by causing cells to take up glucose, utilise it for various purposes, or store it. This suggests that more insulin is created the greater the level of glucose in diet.

Learn more about Insulin here

https://brainly.com/question/30838007

#SPJ11

what basic principles characterize biological theories of crime causation

Answers

Biological theories of crime causation seek to explain criminal behavior through biological factors and processes.

While different theories may have varying emphases, some basic principles commonly characterize biological theories of crime causation:

1. Genetic Factors: Biological theories recognize that genetics play a role in criminal behavior. They suggest that certain genetic predispositions or inherited traits may contribute to an increased likelihood of engaging in criminal activities.

These traits could involve aspects like impulsivity, aggression, or low self-control, which may have a genetic basis.

2. Brain Structure and Function: Biological theories consider the influence of brain structure and function on criminal behavior. They propose that abnormalities or dysfunctions in specific brain regions, neurotransmitter systems, or hormonal imbalances can impact an individual's propensity for criminal behavior.

For example, deficits in the prefrontal cortex, which is associated with decision-making and impulse control, may contribute to criminal behavior.

3. Biochemical Factors: Biological theories examine the role of biochemical factors in crime causation. They suggest that imbalances in neurotransmitters or hormones, such as serotonin, dopamine, or testosterone, can influence an individual's aggression, impulsivity, or risk-taking behavior, potentially increasing the likelihood of criminal involvement.

4. Evolutionary Explanations: Some biological theories incorporate evolutionary perspectives to explain crime causation. They propose that certain behaviors or traits that were adaptive in ancestral environments may manifest as criminal behavior in contemporary society.

For example, aggressive behavior might have been beneficial for survival in certain contexts but can lead to criminal acts in modern social settings.

5. Interaction of Biology and Environment: Biological theories acknowledge that the interaction between biological factors and environmental influences is essential in understanding crime causation.

Genetic predispositions or biological vulnerabilities may be expressed or exacerbated by adverse environmental factors, such as childhood maltreatment, exposure to violence, or substance abuse, increasing the likelihood of criminal behavior.

6. Individual Differences: Biological theories recognize that individual differences in biological makeup can contribute to variations in criminal behavior.

Not all individuals with similar biological factors will engage in criminal activities, as environmental, social, and psychological factors also play crucial roles in determining whether someone will become involved in criminal behavior.

It's important to note that biological theories of crime causation are just one perspective among many in the field of criminology.

They are often considered alongside sociological, psychological, and environmental theories to provide a comprehensive understanding of criminal behavior.

To know more about Biological theories refer  here

https://brainly.com/question/29784467#

#SPJ11

research on the genetic contribution of drug abuse has shown that? a. genetic risk factors are stronger for "hard" drugs, such as stimulants and hallucinogens.
b.genetic risk factors appear to be the same no matter what the drug.
c.genetic risk is strongest for alcohol.
d.only marijuana use has been shown to be unrelated to genetic risk.

Answers

Research on the genetic contribution of drug abuse has shown that genetic risk factors play a significant role in an individual's susceptibility to drug addiction.

Studies have found that certain genetic variations may increase an individual's risk for addiction, particularly for "hard" drugs such as stimulants and opioids. While genetic factors may play a stronger role in some types of drug abuse, such as nicotine addiction, it is important to note that environmental factors also play a significant role in addiction. Social, cultural, and psychological factors can all influence an individual's likelihood of developing a substance use disorder.

It is also important to note that genetic risk factors for addiction can vary between individuals and populations. Additionally, the relationship between genetics and drug addiction is complex and not fully understood. Nonetheless, research into the genetics of addiction is an important area of study that may lead to new strategies for prevention and treatment of substance use disorders.

Learn more about genetic here:

https://brainly.com/question/32018261

#SPJ11

how to do the rna and protein synthesis gizmo answer key

Answers

Protein synthesis, which is the process by which the genetic information in DNA is utilised to generate proteins, depends on the molecule RNA (ribonucleic acid).

Messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA) are the three primary forms of RNA that are involved in the production of proteins molecule RNA.

To complete the RNA and Protein Synthesis Gizmo activity, follow these steps:
1. Transcription: During transcription, DNA is used as a template to create RNA. In the Gizmo, you will use the DNA strand provided and match RNA nucleotides (A, U, C, G) to their complementary DNA nucleotides.
2. RNA Processing: After transcription, the newly formed RNA strand undergoes processing, where introns are removed and exons are spliced together. In the Gizmo, you will identify and remove the introns, then splice the exons.
3. Translation: Translation is the process of converting the RNA sequence into a protein. The RNA strand is read in groups of three nucleotides called codons. Each codon corresponds to a specific amino acid. In the Gizmo, use the provided codon chart to determine the amino acids for each codon and build the protein chain.
4. Protein Folding: Once the amino acid chain is complete, it folds into a functional protein. The Gizmo will illustrate the folding process for you.
By following these steps, you will complete the RNA and Protein Synthesis Gizmo activity and gain a better understanding of the processes involved in protein synthesis.

Learn more about molecule RNA here

https://brainly.com/question/30755090

#SPJ11

Other Questions
Which statement about measles vaccination by income quintile is true?a.In South Asia, the children of the richest 20% of families are immunized more than two times the rate of children from the poorest 20% of families.b..The gaps in vaccine coverage between income groups is greater in West and Central Africa than among the same groups in South Asia.c. The rates of immunization in West and Central Africa is higher for each income group than for the same groups in South Asia.d. In West and Central Africa, the children of the richest 20% of families are immunized at about two times the rate of children from the poorest 20% of families. Emilio is not an employee of the Modesto Corporation, but was hired as a management consultant to provide unbiased advice about Modesto's financial condition. Emilio is a(n) ________.A) internal auditorB) government accountantC) public accountantD) management accountant how did ancient cultures group the stars in the sky An appropriate capital budgeting process requires that the following steps are taken in which order? a)collection of data b)reevaluation and adjustment c)evaluation and decision making d)search for and discovery of investment opportunities The count in a bacteria culture was 100 after 10 minutes and 1600 after 30 minutes. Assuming the count grows exponentially, What was the initial size of the culture? Find the doubling period. Find the population after 70 minutes. When will the population reach 14000 You may enter the exact value or round to 2 decimal places Which of the following alkyl halides would react the fastest with H2O in an Syi reaction?CH CH.CH.CH,Br (CHs)CHCH,BrCH CH,CH(CH,)Br (CH);CBrSelect one: O a. CH, CH.CH.CH, Br b. (CH.),CHCH,BrO c. CH.CH.CH(CH,)BrO d. (CH) CBr An alpha -value = 0.2 will cause an exponential smoothing forecast to react more quickly to a sudden drop in demand than will an alpha -value = 0.4. Please provide your written response and explain your rationale. 305.79 of 0 burned with CH6 How manymoles of CO2 1. If g(x)=x^2+6x with x-3, find g-1(7)2. Use f(x)=2x-3 and g(x)=5-x^2 to evaluate the expression.a) (f o f) (x)(b) (g o g)(x)3. By definition, (f o g)(x) = _____. So if g(1)=3 and f(3)=17, then (f o g)(1)=______.4. Find f+g, fg, and f/g and their domains.f(x)=9-x2. g(x)=x^2-4 In 4-5 sentences, reflect on King's letter from Birmingham Jail. Discuss what parts of the letter resonated with you and why. Make sure you use evidence and support where appropriate Find the cosine of j. write your answer in simplified, rationalized form. Do not round. cos (j) = For directories, even though regular users cannot make hard links to directories, you may observe some directories with high link counts. Why? water flows through a hose of diameter of 0.0028m and fills a 30l bucket in 2 minutesWhat is the speed of the water leaving the end of the hose? after 1851, the u.s. government abandoned the policy of one large reservation in favor of ________. (consider this) ticket scalping is likely to:a. creates economic gains for both buyers and sellers.b. reselling a ticket at a price above its original purchase price.c. pricing tickets so high that an athletic or artistic event will not be sold out.d. an event is not likely to be sold out.e. the demand for tickets has fallen between the time tickets were originally sold and the event takes place. if we borrow 12 bits from a class b address, how many usable subnets have we created? which of the following are potential payoffs for a covered call? multiple select question. strike price (if the strike price exceeds the stock price) stock price (if the stock price exceeds the strike price) 0 stock price (if the strike price exceeds the stock price) strike price (if the stock price exceeds the strike price) Which of the following describesan ambulatory scenario?A. a person that is bedridden and unable to walkB. a person standing stillC. a person walking around a hospital which correctly pairs an indoor pollutant with its source? pls help me it is very easy