What Is Chemogeny ( Chemical Evolution ) ? And Explain The Steps Of Chemogeny [Both Answer In Simple Word/ Simple Answer Which Is Easy To Concept Or Read]​

Answers

Answer 1

Answer:

Chemogeny may be a theory of chemical evolution that depends on the chemical reactions and formation of drugs on the bases of chemical reactions. This theory says that “Life occurs as a results of evolution of inorganic matter”.

In the 1920's Scientists Oparin and Haldane, developed this hypothesis of the chemical origin of life from the primitive atmosphere of the world having matter like methane, ammonia and water. there have been very low concentrations of oxygen thanks to the presence of high temperatures like 5000-60000C. So, these conditions weren't suitable for the free existence of organic compounds, so reactions started happening .

Under conditions like high sunlight and warmth , inorganic matter gets converted to inorganic compounds. And this might end in the storage of organic compounds, which gets more and more concentrated with the passage of many years.

These compounds interact with one another and end in “life”.

So, chemogeny is that the process of chemical evolution of earth and formation of life from pre-existing matter with the assistance of chemical reactions.

Explanation:

Hopefully I was able to help you with the concept. Good luck!

Answer 2
∙ Chemogeny, or the Chemical Evolution of Life, is the formation of complex organic molecules from simpler inorganic molecules in the oceans by chemical reactions during the Earth's early history.
∙ It is the first step in the evolution of life on this planet that occurred in less than a billion years.
Steps involved in chemogeny are:
Formation of simple inorganic molecules like water, methane, and ammonia in the primitive atmosphere of the earth.
Formation of simple organic molecules from inorganic molecules.
Formation of complex organic molecules like carbohydrates proteins, and fats.

Related Questions

thrips are insects that feed on rose

Answers

Answer:

????????????????????????


4. What is a function of the nucleus of an animal cell?
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
C. It defends the cell from infections.
D. It captures sunlight to produce food.
5. Select a statement that best completes the phrase below. In a plant

Answers

Answer:

A. It is the place where energy is produced.

It stores the genetic information, the DNA (chromosomes).

Explanation:

Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced

Answers

Answer:

Glucose

Explanation:

Only glucose is produced in the light independent stage of the reaction

How can carbon can be stored for a short time in the natural cycle?

Answers

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.

As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably?

Answers

Use resources responsibly and don’t waste resources for things you don’t need.

What does fat become after the chemical process?

Answers

Answer:

uR mOtHeR

Explanation:

dUnno im sorry and very bored

After we eat food, the digestive system uses enzymes to: break proteins down into amino acids. turn fats into fatty acids. turn carbohydrates into simple sugars (for example, glucose)

current definition

please help​

Answers

Answer: now or like presently

Explanation:

I dont know

what is chloride shift ​

Answers

The chloride shift is an exchange of ions that takes place in our red blood cells in order to ensure that no build up of electric change takes place during gas exchange.

Which of the following statements is FALSE?

Answers

Answer:

I'll wait for some possible answers...

which fungus does contain mycelium?​

Answers

Answer:

Mycelium is part of the fungi kingdom and is the network of threads, called hyphae, from which mushrooms grow. Not all mycelia fruit mushrooms, depending on the environmental conditions, but all mushrooms come from mycelia.

Explanation:

2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur ​

Answers

Answer:

option a) is correct.

Explanation:

in IVF the fertilisation is always external.

IVF involves combining eggs and sperm outside the body in a laboratory.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

help please asap!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Basidiomycotes

the second one

Explanation:

Answer it correctly please

Answers

The first. One will be Guard cell

Answer the following qs :
1- Mention three uses or benefits of fungi ?

Answers

Answer:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Explanation:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Most Americans/Canada say they hope to die __________.

Answers

i think they hope to die at home

What causes STI's & how are they transmitted?

Answers

Answer

I think the cause would be unprotected sex and well that would also be how its transmitted.

Explanation:

1. What is the major source of energy for the brain

Answers

Explanation:

glucose

The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.

hope its helpful to you #

The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.

What is the brain?

The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.

Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.

The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.

Thus, glucose is the major source of energy for the brain.

To learn more about energy, refer to the link:

https://brainly.com/question/781388

#SPJ2

An area that has been sampled to have a large population of organisms. Does this represent high biodiversity? Why or why not?

Answers

An area that has been sampled to have a large population of organisms is

regarded as having a high biodiversity.

Biodiversity is defined as the condition in which areas have a high amount

of plant and animal species present there. Any place with a large population

of organisms is said to have a high biodiversity while places with low

population of organisms have low biodiversity.

The stated facts therefore makes an area that has been sampled to have a

large population of organisms represents high biodiversity.

Read more on https://brainly.com/question/18727662

4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?

Answers

Answer:

They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.

As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.

Why are there not many vaccines for fungal & parasite disease as we have for viral and bacterial disease?

Answers

Answer:

it is very easy to kill the pathogen by vaccination but it is very difficult to detoxify the toxins produced in the host.

Explanation:

Hopefully this helped!

explain how biodiversity affects ecosystem services.

Answers

ecosystem services provided by biodiversity, such as nutrient cycling, carbon sequestration, pest regulation and pollination, sustain agricultural productivity. Climate change and other stresses have the potential to make major impacts on key functions, such as pollination and pest regulation services.

Why is it necessary for there to be variation in population in order for evolution by natural selection to occur?

Answers

Answer:

There needs to be variations in population in order for natural selection to occur because the entire point of evolution by natural selection is only the best variations will survive. So if there were no variations then there would be no natural selection because the animal's survival rate would be the same no matter how many times they reproduce because there are no different variations being introduced into the species. However, if there are variations then the animal's survival rate could be impacted because of the variations, for example, white mice would be easier to find for predators on a dark surface, while a darker mice would be harder to find for predators on a dark surface, thus, allowing the darker mice to prevail as they have a higher survival rate and the species will slowly evolve into the darker mice. But, if there were no evolution, in this case, then no matter what happens, the white mice would not be able to evolve into a darker mice because there are no such thing as variation. That is why it is necessary for there to be variation in order for evolution by natural selection to occur.

A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of

Answers

Answer:

Convergence

Explanation:

g The hormone __________ induces is lipolysis, whereas the hormone __________ inhibits the process. insulin; norepinephrine glucagon; insulin insulin; glucagon epinephrine; adrenocorticotropic hormone epinephrine; glucagon

Answers

1)noradrenaline
2) adenosine

Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas

Answers

Answer:

Nope

Explanation:

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

In which of these does a chemical change take place?
mixture
compound
solution
none of the above

Answers

Mixture because it’s reacting to a chemical change
Other Questions
Find the perimeter of the window to the nearest tenth 10cm If Sally has 5 apples and Joe has 2 more apples than Sally but Joe gets robbed how many apples does Sally and Joe have all together .I want a way to solve this question 2. What are the two major subdivisions of the nervous system, and what does each division do? At the store one pack of pencils are on sale 4 for $1.25. Another pack has 8 pencils for $2.50 with 20% off. Which is the better deal? how to make swelling go down after wisdom teeth removal? Monitoring environmental parameters can help policy makers determine _______. a. the level of impact a human activity has on an environment b. how society feels about the proposed policy changes c. how frequently a specific environment is used for human activity d. all of the above Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Need help ASAP!!!!!! One group of students is investigating the properties of the bar magnet shown below.Bar magnetThe students' observations are listed below.When an iron nail is taken near the North Pole (N) of the bar magnet, it is pulled towards the magnet.When an iron nail is taken near the South Pole (S) of the bar magnet, it is pulled towards the magnet.The experiment was repeated by several students using different bar magnets. Based on the investigations, which of these theories would the students most likely propose? Group of answer choicesmagnets attract iron nailsthe poles of a magnet attract all materialsiron nails are attracted towards all materialsiron nails have the same properties as magnets plz help me to answer please tell me how do I answer questions. I repeat I need to know how to answer the questions? tell me please Write a program that asks the user for his or her name, then asks the user to enter a sentence that describes himself or herself. The program should ask for a destination file to save as the last question. The United States and Canada have the production possibilities curves shown above. It is determined that the United States has the comparative advantage in peanuts. Will both nations gain from trade if the terms of trade that are offered are 1 Peanut= 3 Corn? Why or why not? Show your work. This is economics In Lord of the Flies Chapter 7, when Jack exhibits reluctance to step up as a courageous leader, what effect does it have on Ralph? A block has 73 kg is being pushed and accelerated at rate of 10 m/s. what force is being applied to the block?730 N7.3 N7300 N730 Kg If you help me you get 100 points please helppppppp Proteins are synthesized based on genetic information carried by DNA. Explain In youre own words how the structure of DNA is important in thesynthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved inprotein synthesis. Nisha can sing that song very well.In the sentence above, can sing is theWhat verb is correct A. verb phrase.C. main verb.B. helping verb.D. helping action. Solve.4 Joe solved (2x + 4) > 2(2x + 8) + 1 as shown at theright. What error did Joe make? Solve the inequality.(8)