What is mechanical digestion? Describe the first stage of mechanical digestion.

Answers

Answer 1

Mechanical digestion means breaking down food mechanically. By chewing and tearing with teeth, food breaks down into smaller parts and no enzymes are used.

What is the first step in mechanical digestion?

The complex pieces of food that are eaten have to be split into simpler particles that can be acted upon by different enzymes.

This is mechanical digestion, which starts in the mouth with chewing or mastication and continues with churning and combining actions in the stomach.

Thus, this could be the answer.

To learn more about Mechanical digestion click here:

https://brainly.com/question/1283194

#SPJ1


Related Questions

If you find a rock that has a belemnite fossil in it. how old is the rock? Explain your reasoning

Answers

Answer:

See below.

Explanation:

Belemnites is a genus of an extinct group of cephalopodsThese cephalopods existed in the Early Jurassic period from the Hettangian age (196.5–199.6 million years ago) to the Toarcian age (175.6–183.0 million years ago). Therefore, the discovered rock could be anywhere from 175.6 - 196.5 million years old

Which change in surface water will cause a decrease in groundwater?
a.rising temperature melt glaciers
b.drought decreases the flow of streams
c.treated wastewater is released over a field
d. water conservation methods are adopted by a town

Answers

Answer: D

Explanation:

How are the bodies of the three animals similar to one another? How are they different?

Answers

Answer:

How are animals similar? All animals are made of many cells. Most animals can move on their own. Like all living things, animals grow, change, reproduce, and respond to their environment.

Animals are made up of several cells. Most animals have independent movement. Animals develop, transform, reproduce, and react to their surroundings like all other living creatures do.

What are considered as animals?

Any eukaryotic multicellular organism of the biological kingdom Animalia is referred to as an animal.

The majority of creatures in this kingdom lack a cell wall, are heterotrophic, motile, have specialised sensory organs, and originate from blastulae during embryonic development.

According to some, the fundamental distinctions between humans and other animal species are our capacity for complex reasoning, our use of complex language.

Also, the capacity for problem-solving, and the capacity for introspection (this means describing your own thoughts and feelings).

Multiple cells make up an animal. The majority of animals can move on their own. Like all other living things, animals grow, change, reproduce, and respond to their surroundings.

Thus, this way, many animals contrasts each other.

For more details regarding animals, visit:

https://brainly.com/question/12985710

#SPJ2

Under what circumstances would a food pyramid be a more useful model than a food chain?

Answers

Answer:

A food chain represents the linear relationship between organisms for food. On the other hand, a food pyramid represents the optimal number of servings to be eaten each day from each of the basic food groups.

Food pyramid represents the total number of food to be eaten each day from each of the basic food groups .A food chain represents the linear relationship between organisms for food.

What is food chain?

Food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another.

What is food pyramid?

Food pyramid is a depiction of the optimal number of servings to be eaten each day from each of the basic food groups.

To learn more about Food pyramid , here

https://brainly.com/question/17234521

#SPJ2

Can a cell be an organism on its own

Answers

Conclusion. Cells are the smallest common denominator of life. Some cells are organisms unto themselves; others are part of multicellular organisms. All cells are made from the same major classes of organic molecules: nucleic acids, proteins, carbohydrates, and lipids.

nah cant

Explanation:

cuz and organisms definition is:

an individual animal, plant, or single-celled life form.

SINGLE-celled life form meaning all the cells are the same

hope this helps :D

What three identifying features of a chromosome are used to pair homologous chromosomes in a karyotype?.

Answers

Answer:

To "read" a set of chromosomes, scientists use three key features to identify their similarities and differences:

Size. This is the easiest way to tell chromosomes apart.

Banding pattern. The size and location of Giemsa bands make each chromosome unique.

Centromere position. Centromeres appear as a constriction.

Explanation:

How is gravity simulated on the hermes spacecraft?.

Answers

Answer:

A section of the spacecraft is slowly rotated in order to simulate the force of gravity.

Explanation:

The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.

Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel is called __________ vascular catheterization.

Answers

It is called central vascular catheterization

Importance of catheterization

Catheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.

Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.

There are different types of vascular catheterization which include:

Arteriovenous (AV) fistula,

Arteriovenous (AV) graft and

Central venous catheter (CVC)

Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.

Learn more about catheterization here:

https://brainly.com/question/3911876

In photosynthesis what is the end product of carbon dioxide?

Answers

Answer:

Carbohydrates(glucose) and Oxygen.

Explanation:

During the process of photosynthesis, Carbon dioxide and Water combine in the presence of Sunlight and Chlorophyll to produce Carbohydrates (glucose) and Oxygen. Thus, the end products of photosynthesis are Carbohydrates(glucose) and Oxygen.

Based on the diagram, what would happen if Earth had no atmosphere?

Diagram of greenhouse effect showing the sun, atmosphere, and human activities that release greenhouse gases. The diagram shows that sunlight is reflected back to space by the atmosphere, absorbed at the surface, and reflected by the surface. Greenhouse gases trap heat from the sun. Examples of human activities include CFCs and haloalkane from refrigerators and aerosols, nitrous oxide from gasoline and agriculture, methane from cattle and fertilizer, and carbon dioxide from oil and coal.

Human activities would not release greenhouse gases.
Greenhouse gases would not trap heat from the sun.
Sunlight would not be absorbed at the surface.
Surface temperatures would be maintained.

Answers

Based on the diagram, we can confirm that if Earth had no atmosphere, Greenhouse gases would not trap heat from the sun.

Why would these gases not trap heat from the sun without the atmosphere?

Greenhouse gases are located in the atmosphere, therefore, without it, they would not be able to trap the heat from the sun. Although high concentrations of these gases are a modern problem in global warming, these gases are a natural part of the earth and are necessary to maintain livable temperatures at the surface of the earth.

Therefore, we can confirm that if Earth had no atmosphere, Greenhouse gases would not trap heat from the sun.

To learn more about greenhouse gases visit:

https://brainly.com/question/11595872?referrer=searchResults

Answer:

Greenhouse gases would not trap heat from the sun.

Got it right. Have a great day!

When two protein chains combine to form an active protein, the structural level is ________

Answers

When two protein chains combine to form an active protein, the structural level is quaternary.

What is a quaternary structure?

The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.

The quaternary protein structure refers to the different arrangements generated by different protein subunits.

The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.

Learn more about quaternary structure here:

https://brainly.com/question/5286438

When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

What do you mean by Proteins?

Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.

The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.

Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

To learn more about Protein structures, refer to the link:

https://brainly.com/question/14207491

#SPJ4

what is the approximate time of death if the body temperature was 10 degrees celcius

Answers

Answer:

I think it would be 2 to 3 days am so sorry if am wrong

Explanation:

F = c * {9/5} + 32 is the equation

F = 10 * {9/5}

F = 10 * 1.8

F = 18

What makes erythrocytes unique from other cellular components of the blood?.

Answers

Answer:They contain hemoglobin.

Explanation:

Hello people ~
The interspecific interaction in which one partner is benefitted and the other is unaffected (neutral), is called
(a) amensalism
(b) mutualism
(c) competition
(d) commensalism

Answers

Answer:

it is called commensalism

Explanation:

because it benefits one and other derives neither benefit nor harm

Answer:

Commensalism

Explanation:

It is a symbiotic relationship in which one benefitted and the other one is neither benefitted nor harmed..

A rural, forested area receives a lot of rain in a short amount of time. What would most likely cause potential flooding in the area?

Answers

The most likely cause potential flooding in the area will be saturation of the ground with water.

What is Flooding?

This is defined as a situation in which an overflow of water submerges land that is usually dry.

When the ground is already saturated with water, a forested area receiving a lot of rain in a short amount of time will lead to flooding.

Read more about Flooding here https://brainly.com/question/12686086

There was a change in the environment between generations 10 and 30. the change likely .

Answers

These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.

Every era of organisms inherits trends owned via way of means of their mother and father via genes. Changes (known as mutations) in this gene will new trends withinside the offspring of an organism. In an organism's populace, a few trends become greater common, even as others will disappear.This technique is known as herbal selection. The profits of greater offspring than the variety of mother and father at the side of the inheritance.

What are heredity mutations?

Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.

Thus it is well explained.

To learn more about evolution refer to the link :

https://brainly.com/question/1144962

Answer:

✔ favored trait A

Explanation:

An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.

It decreased in frequency over time.

It became extinct.

It is carried on a recessive allele.

There was a change in the environment between generations 10 and 30. The change likely

✔ favored trait A.

Which of the following best explains why deforestation increases the risk of floods in an area? a. Tree leaves catch and retain rain water. B. Trees block the free flow of water. C. Deforestation increases precipitation. D. Tree roots improve soil water retention. Please select the best answer from the choices provided A B C D.

Answers

Tree roots improve soil water retention

Deforestation increases the risk of floods in an area tree roots improve soil water retention.

Why does deforestation result in higher flood risk?

When deforestation takes place, the top layer of soil can be dislodged – this is also known as soil erosion.

When the top layer of soil is unstable, it is unable to retain any of the water that falls on it, resulting in increased surface run-off, which, in turn, increases the risk of flooding.

Thus, option "D" is correct.

To learn more about deforestation click here:

https://brainly.com/question/17178423

.......................................................
..........................................................
///////////////////////////

Answers

Answer:

2 2/9

Explanation:

5 x 4/9

20/9

divide 20 by 9

= 2 2/9

Answer:

2[tex]\frac{2}{9}[/tex] is the answer

Explanation:

hope this helps

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Answers

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

The weight of an object also depends on

Answers

Answer:

the value of the acceleration of gravity.

Explanation:

What system plays a vital role in the existence of the human species?


What's the ans?

Answers

Answer:

The reproductive system.

Explanation:

Without the reproductive system, humans are not able to reproduce meaning the human species would go extinct. With the reproductive system, humans are able to create more humans, in this way humans do not go extinct.

1. Is sneezing and coughing on clothes better than using tissue paper?
2. Do disinfect wipes work effectively?

Answers

Answer:

1. no because the bacteria will stik on your clothes

2. yeah

how much water is in our bodies

Answers

Answer:

60%

Explanation:

Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.

I hope this helps you

:)

How is ocean acidification important to the world?

Answers

Answer:

Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.

18 The size of a mouse population in a natural
ecosystem tends to remain relatively constant due to
A. the cycling of energy.
B. the lack of natural predators.
C. the increased numbers of decomposers.
D. the carrying capacity of the environment.

Answers

Answer:

D- the carrying capacity of the environment.

Explanation:

The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant. Therefore, option (D) is correct.

What is a limiting factor in a ecosystem?

Limiting factors are physical, biological, and ecological conditions that:

(1)  Limit the ecosystem's ability to sustain native plant and animal populations and to accommodate natural disturbances like floods;

(2) Limit the quality or availability of habitat that supports all life stages of  native species; and

(3)  Limit the ecosystem's ability to sustain the local tribal culture.

The only natural factor limiting the number of mice in the home is a scarcity of resources such as food. Therefore, The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant.

Learn more about carrying capacity, here:

https://brainly.com/question/2375972

#SPJ2

In a population of pea plants such as the one below, bees and other pollinators prefer to land on purple colored flowers. Over generations, more and more purple flowers successfully reproduce due to this pollinator preference. Which of the following statements accurately describes what is happening to the pea plants over time?



Question 2 options:

Natural selection causes evolution in the population of pea plants and leads to increased overall variation.


Natural selection causes evolution of individual pea plants and leads to increased overall variation.


Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.


Natural selection causes evolution of individual pea plants and leads to an increase in favorable adaptations.

Answers

Answer:

Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.

Explanation:

The flowers will evolve to keep that purple trait in order to continue their population growth, hence why it is not individual evolution but as a population. Also since the purple color is a favorable trait it will lead to an increase in favorable adaptations and will decrease variation.

What happens to the lac operon when both glucose and lactose are present?

Answers

Answer:

If both glucose and lactose are both present, lactose binds to the repressor and prevents it from binding to the operator region. The block of lac gene transcription is thus lifted, and a small amount of mRNA is produced.

Explanation:

Three examples of mitotic reproduction are __________________________, __________________________, and _______________________________

Answers

Answer:

Yeast budding. Binary fission. Replacement of worn out tissues.

Explanation:

Topic : Photosynthesis and Energy transfer in food chains
App : Teams Homework


Note : it’s ok if u can’t write an essay but can anyone please share their ideas so I can put it together

Answers

Introduction:The sun warms our seas,stirs our atmosphere,generates our weather patterns ,and gives energy to the growing green plants that provide the food and oxygen for life on Earth.Description:Primary producers use energy from the sun to produce their own food in the form of glucose ,and then primary producers are eaten by primary consumers who are in turn eaten by secondary consumers ,and so on,so that energy flows from one trophic level,or level of the food chain ,to the next .Energy decreases as it moves up trophic levels because energy is lost as metabolic Heat when the organisms from one trophic level are consumed by organisms from the next level,food chain can usually sustain no more than six energy transfers before all the energy is used.Explore:Note : This one's for you(◕ᴗ◕✿)Evaluate:Note: This one's for you

i hope it's helpful.

where is the digestive and circulatory system connected?
a. alveoil
b. villi
c. artery
d. pancreas​

Answers

Answer:

The products of the digestive system are actually tied directly to the circulatory system in that the organs of the digestive system are used to turn ingested food into products that can be absorbed by the blood and then carried to other organs for use as energy or other functions.

Explanation:

Answer:

b) Villi

Explanation:

The digestive and circulatory system is connected by villi.

It is the tiny finger-like projections that line inside of small intestine. Therefore, option (b) is the answer.

Other Questions
Que es el verbo? Que es el adjetivo? Why are streak plates used the test minerals? A. They show you the silicon content of the minerals B. They show you the colors of the impurities in the mineral C. They show you the true color of the minerals When did the constitution give all adult men the right to vote?. Which statement accurately compares timber and sunlight? timber and sunlight are nonrenewable resources. timber and sunlight are renewable resources. timber is a renewable resource, and sunlight is a nonrenewable resource. timber is a nonrenewable resource, and sunlight is a renewable resource. George wanted to measure the angle of a water slide at the lake. He used a sheet of folded paper that formed a 20 angle. He measured and found that three of the folded paper angles would fit in the angle made by the slide and the ground.Which of the following was the angle of the water slide? PLEASE HURRYSolve the inequality and express your answer in interval notation.x2 + 8x-7 Is my answer correct? Which action best illustrates jacob riis's response toward the conditionshe witnessed in new york's lower east side? *civil disobediencesettlement workmuckrakingboycotting As a team lead, Emilio has convened a group of five team members to solve an issue with the marketing campaign. This is an example of a(n) Which expression is the factorization of x2 10x 21? Which of the following things are symbolized by the color gold in the outsiders use the data in the table below to determine whether each plant is a short-day plant, a long-day plant, a day-neutral plant, or a plant that cannot be classified based on the data. Which section of a budget would the monthly electric bill best belong in?A. Housing and utilitiesB. Meals and entertainmentC. Groceries and suppliesD. Transportation Can someone do this for me What should you do to keep your audience engaged? Check all that apply.use eye contact by looking around at different members of the audiencespeak with a clear, loud voice that can be heard in the room I am presenting inread from my notes so I do not miss any important pointsinclude informal language to make sure my audience is paying attentionstand tall and interact with the multimedia The average daily rainfall in Seattle for the month of June has a mean absolute deviation of 1.3 inches. What conclusion can you make about the average daily rainfall in Seattle for the month of June? Two of which shape can make a circle 2 examples of federalism What movies should a 31 year old man watch? A painter bought 14 gallons of paint just enough to cover 2 room