what is most likely to occur when the sun, moon, and earth are aligned in a relatively straight line?

Answers

Answer 1

Answer: An a eclipse will occur

Explanation: When this happens, the Moon blocks the light of the Sun from reaching Earth. This causes an eclipse of the Sun, or a solar eclipse. During a solar eclipse, the Moon casts a shadow onto Earth.


Related Questions

SEMESTER EXAM QUESTION HELP!!! : Select the region with the highest elevation

a.Mountains and Basins
b.Great Plains
c.North Central Plains
d.Coastal Plains

Answers

Answer:

l think mountain and basins

How can colonial history affect the quality of life?

Answers

Colonialism's impacts include environmental degradation, the spread of disease, economic instability, ethnic rivalries, and human rights violations—issues that can long outlast one group's colonial rule

the global patterns of atmospheric circulation and precipitation occur because of

Answers

The global patterns of atmospheric circulation and precipitation occur because of rising masses of warm air and sinking masses of cool air. Currents in the ocean can have a warming or cooling effect on land climates.

the fictional jurassic park is located off the coast of what real country?

Answers

Answer:

The film is set on the fictional island of Isla Nublar, located off Central America's Pacific Coast near Costa Rica.

Explanation: I am a HUGE Jurassic Park fan.

The fictional Jurassic Park is located off the coast of Costa Rica real country.

What is Jurassic Park?

Jurassic Park was the famous English classic adventure movie. The Jurassic Park was the directed the movie by Steven Spielberg. This movie was the based on the novel by Michael Crichton. The main screen play by Crichton and David Koepp. It was not exist.

The Jurassic Park islands are supposed to be in Central America, while the exact location of the filming is Hawaii. The fictitious tropical island is 120 miles west of Costa Rica and is home to a dormant volcano. Unfortunately, it was not a genuine Costa Rican island, and the film sequence takes place on the Isla del Coco.

As a result, the fictional Jurassic Park is located off the coast of Costa Rica real country.

Learn more about on Jurassic Park, here:

https://brainly.com/question/3788190

#SPJ6

What happened to Germany after Charlemagne's death?
Germany broke up into small, independent political units.
Western powers occupied Germany.
Germany suffered a major economic collapse.
Adolf Hitler and the Nazi Party took power.

Answers

Answer:

Adolf Hitler and the Nazi Party took power .

The incident that happened to Germany after Charlemagne's death is that Adolf Hitler and the Nazi Party took power.

What happened when Charlemagne's died?

After the death of Charlemagne then the Carolingian Empire weakened and empire was divided into three parts and after this Adolf Hitler and the Nazi Party took power

Therefore option D is correct.

Learn more about Charlemagne's death at;

https://brainly.com/question/3121065

what type of weather occurs when pressure rises and temperatures rise

Answers

Answer: Weather in a high-pressure system is usually drier.

Explanation:

As the sinking air increases in pressure and temperature, the number of clouds in the sky decreases leaving less chance for precipitation. Some avid fishermen even swear by a rising barometer to get their best catches!

Demography is the scientific study of population characteristics
O True
O False

Answers

Answer:

true is the answer I think

It’s true but i dont know

What is the most common substance that is dissolved in ocean water?

Answers

Answer:

The most common substance would be Sodium Chloride

Southern Colorado is more densely populated than the northern part of the state

Answers

It is false, because Denver is the most populated and it is in the Northern part of colorodo

Give a descriptive case study of the floods of 2021 of sangli and kolhapur

Answers

Give a descriptive case study of the floods of 2021 of sangli and kolhapur.

Answer ; Starting on 22 July 2021, Maharashtra saw heavy rainfall in many of its western districts. On 23 July 2021, NDTV reported that Maharashtra saw the highest rainfall in the month of July in 40 years.[4]Starting on 22 July 2021, Maharashtra saw heavy rainfall in many of its western districts. On 23 July 2021, NDTV reported that Maharashtra saw the highest rainfall in the month of July in 40 years.[4]Climate change could have played an important role in causing large-scale floods across Maharashtra.[5] The observed data shows a three-fold rise in widespread extreme rainfall events across India, including those regions where the floods occurred. The local meteorological conditions showed the presence of a low pressure system in the Bay of Bengal, anchoring the monsoon westerlies blowing from the Arabian Sea. These westerlies brought in an anomalous amount of moisture from the warm Arabian Sea, releasing them as heavy-to-extreme rains across Maharashtra over a week's time.[6] In April 2021, Potsdam Institute for Climate Impact Research reported about climate change heavily impacting the monsoon seasons in India.[3]

how long do we have until climate change is irreversible

Answers

Answer:

it would take over one thousand years to disintegrate completely and potentially thousands of year longer if we manage to cut emissions quickly.

.

.

.

.

What does this chart reveal about education in South Africa? How do you think this will affect the economy?

Answers

South Africa is a country located at the southern tip of Africa. It has had a rich colonial history since the seventeenth century. In 1652, the Dutch came and founded a colony on the Cape.

After a century and a half of Dutch colonization, the Cape Colony was taken over by the United Kingdom. As a result, a large number of Dutch-speaking settlers, known as Boers, migrated inland with the Great Trek and founded several Boer states, of which the South African Republic and the Orange Free State were ultimately the most important. These republics were conquered by the British in 1902 in the Second Boer War and united together with the Cape Colony and Natal to form South Africa in 1910.

In the 20th century, South Africa was overshadowed by apartheid, a system of racial segregation that systematically disadvantaged the non-white population. Apartheid was abolished in 1990 and Nelson Mandela was elected South Africa's first black president in 1994.

South Africa is a country with diverse population groups and eleven official languages. The country is a parliamentary republic with three capitals and is one of the most developed countries in the continent, but poverty and crime rates remain high.

Learn more about Africa in https://brainly.com/question/14304779

Complete the first step of the indirect proof of the following statement:
"4X+3>12"
Assume temporarily that 4x+3 12.
Ο>
O<
O<
0=

Answers

We select the symbol of '<' if we assume temporarily for 4x+3 12.

Assume temporarily for 4x+3 12, we select the symbol of '<' because the real equation is "4X+3>12" in which the symbol '>' is used. The symbol '>' is used to show the greater number and a smaller number. The pointed side shows that the number is smaller.

while on the other hand, the wider part shows that the number or value is greater than the other one so we can conclude that we select the symbol of '<' if we assume temporarily for 4x+3 12.

Learn more about equation here: https://brainly.com/question/2972832

Learn more: https://brainly.com/question/25905271

What two Ideas do geographers use when studying movement?

Answers

sorry but

i am just in class 6

What are 10 methods used to uncover the past climates of the earth including their strengths and weakness

Answers

The ten methods used to uncover the past climates of the earth including their strengths and weakness includes:

Making an analysis of the samples of ice core.Making scientific observation of the remnants of glacial land forms.Making a survey of the sediments which are on the floor of the ocean.Checking the fossils of old vegetation.Checking sites of ancient volcanoes.Making calculations of the animals which went extinct during the Ice Age.Dating the fossil of dinosaurs.Making deep glacier explorations.Checking the concentration of greenhouse gases.Checking for plucked rocks and U-shaped valleys.

Thousands and millions of years ago, the climate of the earth was much different and there were different animals and creatures around of which the most popular ones which have gone extinct are the dinosaurs.

With this in mind, humans were probably not around during this time or if they were, they would be unable to write down the climates which people of this day and age would properly interpret, therefore this is where paleoclimatology comes in as it studies the past climates of the earth through various methods which were mentioned above.

Read more about paleoclimatology here:

https://brainly.com/question/25707645

explain how weather and climate are also affected by geologic and geographic factors, such as mountains and ocean temperature

Answers

Answer: explanation on how geography affects the climate

Explanation:

Climate is the prevailing patterns of temperature and precipitation across a region. A region’s climate can be tropical or frigid, rainy or arid, temperate or monsoonal. Geography, or location, is one of the major determining factors in climate across the globe. Geography itself can be divided into components including distance from the equator, elevation above sea level, distance from water and topography, or the relief of the landscape.

Higher Latitudes Have Cooler Climates

Latitude is a measure of distance from the equator. Locations between the Tropic of Cancer and the Tropic of Capricorn, between 23 degrees north and 23 degrees south latitude, are considered tropical. As you move away from the equator, climates shift incrementally through subtropical, temperate, subarctic and, finally, arctic at the poles. The tilt of the Earth on its axis means that the further you get from the equator, the longer the area spends tilted away from the sun each year, and the cooler and more seasonal the climate.

Water Bodies Regulate Precipitation and Moderate Climate

Over 70 percent of the Earth’s surface is covered in water, so it makes sense that water bodies influence climate. Oceans and lakes are very good at storing the heat that is created when the sun’s energy is absorbed by the water. The water heats and adds moisture to the air above it, a process that drives the major air currents around the world. Water bodies also make the climate of adjacent land masses more moderate. They absorb extra heat during warm periods and release it during cooler periods. Warm, moist ocean air drives precipitation patterns around the world when it falls as precipitation as it is carried over cooler land masses.

Mountains Disrupt Air Flow

Mountain ranges are barriers to the smooth movement of air currents across continents. When an air mass encounters mountains, it is slowed and cooled because the air is forced up into cooler parts of the atmosphere in order to move over the obstruction. The cooled air can no longer hold as much moisture and releases it as precipitation on the mountain range. Once the air is over the mountain, it no longer has much moisture, and the leeward side of mountain ranges is drier than the windward side.

Higher Elevations Have Cooler Climates

Climates become cooler and the cold season lasts longer as elevation above sea level rises. This holds true for mountains and high-elevation plateaus, such as the steppes of Mongolia. Every 1.61 kilometers (1 mile) in elevation gain is roughly equivalent to moving 1,290 kilometers (800 miles) further from the equator. Mechanistically, higher elevations have lower air pressure, fewer atoms per unit of air to excite and, thus, cooler temperatures. Mountains frequently receive more precipitation than the surrounding lowlands, but many high-altitude plains are deserts because of their location on the leeward side of a mountain range or continental mass.

Due to Soviet rule, most people in Central Asia speak Russian, but there are numerous other languages and dialects in the region that descend from primarily ________ roots.

Answers

Given what we know, we can confirm that due to Soviet rule, most people in Central Asia speak Russian, but there are numerous other languages and dialects in the region that descend from primarily indigenous roots.

What is meant by indigenous roots?By indigenous roots, we refer to the ancestors of the current-day civilization of Russia. These are the first inhabitants of the land to form civilized groups. Russia is home to many indigenous tribes, that have now adapted to modern life.However, some aspects of the tribes, such as the languages, remain.

Therefore we can confirm that due to Soviet rule, most people in Central Asia speak Russian, but there are numerous other languages and dialects in the region that descend from primarily indigenous roots.

To learn more about indigenous people visit:

https://brainly.com/question/582972?referrer=searchResults

How early civilizations influence people of today? 5 paragraphs

Answers

Ancient Egypt used pictures and symbols as a form of writing just like emoji’s and the Norse said I’ve taken an arrow to the knee when proposing which is why we get down on one knee when proposing

It can be inferred from global patterns of population growth that the country most likely to be in West Africa is?
Country I

Answer A: Country I

Answer B: Country II

Answer C: Country III

Answer D: Country IV

Answers

Based on the patterns seen in the table, the most likely country in West Africa is Country III

West Africa is:

The fastest growing region in terms of population in the world Known to have a high death rate as well

The country with the highest population growth rate over the period is Country III and it also has a high death rate.

We can therefore conclude that Country III is most likely in West Africa.

Find out more at https://brainly.com/question/12228859.

where do the majoraty of australians live

Answers

Answer:

Australia

Explanation:

Answer:

The Eastern Mainland States

Explanation:

Around 80 percent of Australians live in The Eastern Mainland States because it contains areas such as Wales, Victoria, and Queensland.

On either side of a mid-ocean ridge, the lithosphere begins toa.rise because it becomes buoyant.b.sink because it cools and contracts.c.sink because convection pulls it downward.d.rise because it thickens away from the ridge.

Answers

Answer:

Option B is the correct answer.

which european nation attemped to colonize haiti and left an ongoing cultural legacy on haitian society

Answers

Answer:

France

Explanation:

I learned this

mount kosciuszko is the tallest mountain in which country?

Answers

It is the tallest mountain in Australia.

when was the last time a volcano erupted in hawaii

Answers

Answer:

setember 29,2021

Explanation:

The volcano name is kilauea

In which regions of the world does the UN focus most of its attention on when attempting to separate
warring groups?

Answers

Answer:

Explanation:

Maintain International Peace and Security.

Protect Human Rights.

Deliver Humanitarian Aid.

Support Sustainable Development and Climate Action.

Uphold International Law.

Explain two geographical advantages islands have that help promote trade.

Answers

They are remote and can be good locations for ports to be built, they are also often under less trade regulations than many countries and can promote their trade

1: Explain how individual water molecules move in a wave.

Answers

Answer:

Explanation:

individual water molecules move in circles that get smaller with depth and eventually stop altogether

Individual water molecules are seen to flow in circles that become smaller with depth and ultimately halt.

What are water molecules?

Water molecules compromises of two elements. They are:

Hydrogen (2 molecules); andOxygen (1 molecule).

Thus, one should note that Individual water molecules are seen to flow in circles that become smaller with depth and ultimately halt.

Learn more about molecular structure of water at;
https://brainly.com/question/2960517
#SPJ6

what fraction of an iceberg is above the surface of the water?

Answers

Answer:

About 1/10

Explanation:

This is due to the volume, size, and age of the iceberg. Hope this helps :)

50 Points HELP!!!!!!!!!!!!!!!!!!!!!!
Which of the following evidence supports the theory of plate tectonics? (7 points)
A. The age of rocks and mountains on the edge of neighboring continents varies.
B. Fossils from the same species are found on only one continent.
C. Iron-rich, molten magma rocks no longer align to Earth’s poles in many locations.
D. Grooves created from glacier movement travel in opposite directions on each continent.

Answers

Answer:

C

Explanation:

Hope this helped you!!

When Izzy applied force to the golf ball it went in the right direction so why didn’t it go in the hole

Answers

Answer:

Air resistance and fluid friction

Explanation:

Fluid friction is "drag" and that also depends on if the wind is blowing and how fast the wind is blowing and how much force she applied to hit the golf ball. Hope this helps!

Other Questions
Elliot jumps up and down on a pogo stick. He weighs 600.N, and his pogo stick has a spring with spring constant 1100N/m. What is the height he will reach when he has gravitational potential energy 250J? m in the song twelve days of christmas, what is given on the 7th day? A fifth-degree polynomial equation with rational coefficients has the roots 3, 8i, and 7- radical 5. Which are also roots of the polynomial equation? LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) theme of i know my rights by june jordan Draw a nitrogen cycle and explain in short.please help me 32) 48,504 16 33) Is the sum of 15,398 + 7,292 even or odd? Why? 34) Is the product of 312,234 x 8,987 even or odd? Why? I need all of these answers by today!! Pls help right answer gets brainliest A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should