What is the area of a rectangle whose width is n feet and who’s length is 2 feet more than 3 times it’s width in terms of n?

Answers

Answer 1

Answer: The length of the rectangle is given as "2 feet more than 3 times its width."

Let's break it down step by step:

The width of the rectangle is n feet.Three times the width is 3n.Two feet more than 3 times the width is 3n + 2.

The formula for the area of a rectangle is length multiplied by width. So, in terms of n, the area of the rectangle would be:

Area = Length × Width

= (3n + 2) × n

= 3n^2 + 2n

Therefore, the area of the rectangle, in terms of n, is 3n^2 + 2n.


Related Questions

Write a quadratic equation whose roots are 5 + i radical 2 and 5 – i radical 2
____ x^2 + _____ x+ ______=0

Answers

The quadratic equation with roots 5 + i√2 and 5 - i√2 is:

x^2 - 10x + 27 = 0

To write a quadratic equation with roots 5 + i√2 and 5 - i√2, we can use the fact that complex roots occur in conjugate pairs. Therefore, the equation will have the form:

(x - root1)(x - root2) = 0

Substituting the given roots:

(x - (5 + i√2))(x - (5 - i√2)) = 0

Now, we expand the equation:

(x - 5 - i√2)(x - 5 + i√2) = 0

Using the difference of squares formula:

((x - 5)^2 - (i√2)^2) = 0

Simplifying the equation:

(x - 5)^2 + 2 = 0

Expanding the square:

x^2 - 10x + 25 + 2 = 0

Combining like terms:

x^2 - 10x + 27 = 0

Therefore, the quadratic equation with roots 5 + i√2 and 5 - i√2 is:

x^2 - 10x + 27 = 0

For more questions on  quadratic equation

https://brainly.com/question/30262991

#SPJ8

April can buy a package of 10 folders for $1.20 or a package of 8 folders for $1.12. What is the unit price, per folder, in each package?

Each folder in the package of 10 costs $

Each folder in the package of 8 costs $

Answers

Answer:

Step-by-step explanation:

For the package of 10 folders: Unit price = $1.20 / 10 = $0.12 For the package of 8 folders: Unit price = $1.12 / 8 = $0.14

When you encounter these problems, divide the unit price by the amount of products bought

When applied mathematically - 1.20 / 10 = $0.12 (each folder)

1.12 / 8 = $0.14

Here, S.P. = . 1,61, 680 D%= 6%. M.P. = ?​

Answers

The marked price (M.P.) is 1,72,000 when the selling price is 1,61,680 with discount of 6%.

To find the marked price (M.P.), we can use the formula:

M.P. = S.P. / (1 - D%)

Given:

S.P. = 1,61,680

D% = 6%

First, we need to convert the discount percentage to decimal form by dividing it by 100:

D% = 6/100 = 0.06

Now, we can substitute the values into the formula:

M.P. = 1,61,680 / (1 - 0.06)

M.P. = 1,61,680 / 0.94

M.P. = 1,72,000

Therefore, the marked price (M.P.) is approximately 1,72,000.

To learn more on Marked price click:

https://brainly.com/question/28022321

#SPJ1

Select the correct answer. Which value of x from the set [4, 5, 6, 7), makes this equation true? 4(8-x) = 8 OB. 5 OC. OD. 7 C. 6 ​

Answers

Answer:

6

Step-by-step explanation:

The correct answer is C. 6.

If we substitute 6 for x in the equation, we get 4(8-6) = 4(2) = 8.

This is the only value of x that makes the equation true.

Which of the following options represents the phrase "eight less than the quotient of 24 and 12"?

Answers

Hello!:

24/12 - 8

= 2 - 8

= -6

Yesterday, Lily withdrew $25 from her savings account to buy a birthday gift for her grandfather.
What integer represents the change in Lily's account balance?

Answers

The integer number that represents the change in Lily's account balance is given as follows:

-25.

What are integer numbers?

Integer number are numbers that can have either positive or negative signal, but are whole numbers, meaning that they have no decimal part.

For the balance of the bank account, we have that:

Deposits are represented by positive integers.Withdraws are represented by negative integers.

Lily withdrew $25 from her savings account to buy a birthday gift for her grandfather, hence the integer number is given as follows:

-25.

More can be learned about integer numbers at brainly.com/question/17695139

#SPJ1

Find the missing dimension of the cylinder. Round your answer to the nearest whole number.

Volume = $\ 10,000\pi\ $ in.3

A cylindrical piece of a log is shown. The diameter of its base is 32 inches and height is h.

$h\ \approx$
in.

Answers

The nearest Whole number, the missing dimension (height) of the cylinder is approximately 39 inches.

The missing dimension of the cylinder, we can use the formula for the volume of a cylinder:

Volume = π * r^2 * h

Given that the volume is 10,000π in³ and the diameter of the base is 32 inches, we can determine the radius (r) of the cylinder.

The diameter is twice the radius, so the radius is half of the diameter:

r = 32 inches / 2 = 16 inches

Substituting the known values into the volume formula, we have:

10,000π in³ = π * (16 in)^2 * h

Cancelling out the common factor of π, we get:

10,000 = 16^2 * h

Simplifying further:

10,000 = 256 * h

To isolate h, we divide both sides of the equation by 256:

h = 10,000 / 256

Calculating the value of h:

h ≈ 39.06

Rounded to the nearest whole number, the missing dimension (height) of the cylinder is approximately 39 inches.

To know more about Whole number.

https://brainly.com/question/29207899

#SPJ8

Descrive in words the rule that is used to determine the term value from its position in the sequence​

Answers

The rule used to determine the term value from its position in the sequence is often referred to as the "nth term" rule.

What is the nth-term rule?

The nth-term rule involves identifying a pattern or relationship between the position (n) of a term in the sequence and the value of that term.

By analyzing the pattern, such as the common difference or common ratio, the nth-term rule allows us to express the value of any term in the sequence based on its position.

This rule provides a formula or equation that relates the position of a term to its corresponding value in the sequence.

Mathematically, the rule is:

T(n) = a + (n - 1) * d

where:

T(n) represents the value of the term at position n.a represents the first term in the sequence.n represents the position or index of the term in the sequence.d represents the common difference (for arithmetic sequences) or the common ratio (for geometric sequences) between consecutive terms.

More on sequence and series can be found here: https://brainly.com/question/15583579

#SPJ1

Jonah's swimming pool is 21 meters by 20 meters. He swam from one corner of the pool to the opposite corner. How far did Jonah swim?

Answers

Jonah swam a distance of 29 meters from one corner of the pool to the opposite corner.

To determine how far Jonah swam from one corner of the pool to the opposite corner, we can use the Pythagorean theorem. According to the theorem, in a right-angled triangle, the square of the length of the hypotenuse is equal to the sum of the squares of the other two sides.

In this case, the two sides of the right-angled triangle are the length and width of the swimming pool, which are 21 meters and 20 meters respectively. The distance Jonah swam represents the hypotenuse of the triangle.

Using the Pythagorean theorem:

[tex]Hypotenuse^2 = Length^2 + Width^2[/tex]

[tex]Hypotenuse^2[/tex] =[tex]21^2 + 20^2[/tex]

[tex]Hypotenuse^2[/tex]= 441 + 400

[tex]Hypotenuse^2[/tex]= 841

Taking the square root of both sides, we find:

Hypotenuse =[tex]\sqrt{841[/tex]

Hypotenuse = 29

Jonah swam a distance of 29 meters from one corner of the pool to the opposite corner.

According to the Pythagorean theorem, in a right-angled triangle, the square of the length of the hypotenuse is equal to the sum of the squares of the other two sides.

The two sides of the right-angled triangle are the length and width of the swimming pool, which are 21 meters and 20 meters respectively. The distance Jonah swam represents the hypotenuse of the triangle.

Using the Pythagorean theorem:

[tex]Hypotenuse^2 = Length^2 + Width^2\\Hypotenuse^2 = 21^2 + 20^2\\Hypotenuse^2 = 441 + 400\\Hypotenuse^2 = 841[/tex]

Taking the square root of both sides, we find:

Hypotenuse = [tex]\sqrt841[/tex]

Hypotenuse = 29

Jonah swam a distance of 29 meters from one corner of the pool to the opposite corner.

For more such questions on distance

https://brainly.com/question/30395212

#SPJ8

The manufacturer of a DVD player has found the revenue R (in dollars) is R(p) = -4p² + 1700p,
when the unit price is p dollars. What is the maximum revenue to the nearest whole dollar?
a. $722,500
c. $180,625
b. $1,445,000
d. $361,250

Answers

The maximum revenue, to the nearest whole dollar, is $180,625 (option c).

To find the maximum revenue, we need to determine the vertex of the quadratic function represented by the revenue equation.

The revenue equation is given as:

R(p) = -4p² + 1700p

The vertex of a quadratic function in the form of f(x) = ax² + bx + c can be found using the formula:

x = -b / (2a)

For the given revenue equation, a = -4 and b = 1700. Plugging these values into the formula, we have:

p = -1700 / (2 × -4)

p = -1700 / -8

p = 212.5

The maximum revenue occurs at p = 212.5.

To find the maximum revenue, we substitute this value back into the revenue equation:

R(p) = -4(212.5)² + 1700(212.5)

R(p) = -4(45256.25) + 361250

R(p) = -181025 + 361250

R(p) = 180625

Therefore, the maximum revenue, to the nearest whole dollar, is $180,625 (option c).

for such more question on revenue

https://brainly.com/question/16232387

#SPJ8

Triangle ABC, with vertices A(-9,-8), B(-2,-9), and C(-8,-5), is drawn inside a rectangle. What is the area, in square units, of triangle ABC?

Answers

The area of triangle ABC is 19 square units.

To find the area of a triangle, we can use different formulas depending on the information available. Since we have the coordinates of the vertices A(-9, -8), B(-2, -9), and C(-8, -5), we can use the Shoelace Formula (also known as the Gauss's area formula) to calculate the area of the triangle.

The Shoelace Formula states that if the coordinates of the vertices of a triangle are (x1, y1), (x2, y2), and (x3, y3), then the area (A) of the triangle can be calculated as:

Area = 0.5 * |(x1 * (y2 - y3) + x2 * (y3 - y1) + x3 * (y1 - y2))|

Using the coordinates of the vertices A(-9, -8), B(-2, -9), and C(-8, -5), we can substitute these values into the formula to calculate the area.

Let's calculate step by step:

x1 = -9

y1 = -8

x2 = -2

y2 = -9

x3 = -8

y3 = -5

Area = 0.5 * |(-9 * (-9 - (-5)) + (-2) * (-5 - (-8)) + (-8) * ((-8) - (-9)))|

Area = 0.5 * |(-9 * (-4) + (-2) * (3) + (-8) * (-1))|

Area = 0.5 * |(36 + (-6) + 8)|

Area = 0.5 * |(38)|

Area = 0.5 * 38

Area = 19

Therefore, the area of triangle ABC is 19 square units.

For more such questions on area , Visit:

https://brainly.com/question/25292087

#SPJ11

which of the following is the slope of the line with equation -7x=6+3y

Answers

Answer:

Slope = -7/3

Step-by-step explanation:

-7x = 6 + 3y is in the standard form of a line, whose general equation is

Ax = C + By (it's sometimes written in terms of C and is Ax + By = C, but in this problem, it's written in terms of Ax).

We can find the slope of the line by converting from standard form to slope-intercept form, whose general equation is y = mx + b, where

m is the slope,and b is the y-intercept.

Step 1:  Subtract 6 from both sides:

(-7x = 6 + 3y) - 6

-7x - 6 = 3y

Step 2:  Divide both sides by 3 to isolate y:

(-7x - 6 = 3y) / 3

-7/3x - 2 = y

Thus, the slope of the line is -7/3

Answer:  Therefore the slope is [tex]-\frac{7}{3}[/tex].

Step-by-step explanation:

We can rewrite the equation -7x=6+3y in slope-intercept form y = mx + b, where the m is the slope of the line, and b is the y-intercept.

-7x = 6 + 3y

-6     -6        

-7x - 6 = 3y

[tex]\frac{-7x}{3}-\frac{6}{3} =\frac{3y}{3}[/tex]

[tex]\frac{-7}{3}x-2 =y[/tex]

Therefore the slope is [tex]-\frac{7}{3}[/tex].

Saleema
was investigating the newspaper subscriptions
for her local newspaper. At the beginning of the year,
She noted 1000 subscriptions for
Subscribed to the newspaper. The number of subscriptions
left y years,
a small area that
left
Y years after 2012 is represented by the function
shown.
N (y) = 1000 (0.5)Y
Part A
Approximately how many subscriptions were left when
y=5?

Answers

Based on the information, it should be noted that 31.25 subscriptions were left when y=5.

How to calculate the value

From the information, Saleema was investigating the newspaper subscriptions for her local newspaper. At the beginning of the year, She noted 1000 subscriptions for Subscribed to the newspaper

To find the approximate number of subscriptions left when y=5, we can substitute y=5 into the function N(y) = 1000 * (0.5)^y and evaluate it.

N(5) = 1000 * (0.5)^5

N(5) = 1000 * (0.5)^(5)

N(5) = 1000 * (0.03125)

N(5) ≈ 31.25

Approximately 31.25 subscriptions were left when y=5.

Learn more about equations on

https://brainly.com/question/2972832

#SPJ1

50 Points! Multiple choice algebra question. Photo attached. Thank you!

Answers

Answer:

B. 108 ft³

Step-by-step explanation:

solution given:

We have Volume of solid = Area of base * length

over here

base : 9ft

height : 6 ft

length : 4ft

Now

Area of base : Area of traingle:½*base*height=½*9*6=27 ft²

Now

Volume : Area of base*length

Volume: 27ft²*4ft

Therefore Volume of the solid=108 ft³

A jogger running around a rectangular park takes a shortcut back to his car by running 53 meters from one corner to the opposite corner. If the park is 45 meters long, what is the width?

Answers

Answer:

28 meters Aprox

Step-by-step explanation:

To find the width of the rectangular park, we can use the Pythagorean theorem. The diagonal running from one corner to the opposite corner forms a right triangle with the length and width of the park.

Given:

Length of the park (L) = 45 meters

Diagonal distance (d) = 53 meters

Using the Pythagorean theorem:

d² = L² + W²

(53 meters)² = (45 meters)² + W²

2809 = 2025 + W²

W² = 2809 - 2025

W² = 784

Taking the square root of both sides:

W ≈ √784

W ≈ 28

Therefore, the width of the rectangular park is approximately 28 meters.

ILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST SOMEBODY PLEASE PLEASE HELP ME IM BEGGING YOU

Answers

Answer:

B Mean: 17.5  | W Mean: 20.5 | B Mode: 15 | W Mode: 20.5 | B Mode: 14 & 15 | W Mode: 20 & 21 | B Range: 17 | W Range: 3

Step-by-step explanation:

Simplify the following expression.
(6m5g5) 2

Answers

The simplified exponential expression in the context of this problem is given as follows:

[tex](6m^5g^5)^2 = 32m^{10}g^{10}[/tex]

How to simplify the exponential expression?

The exponential expression in the context of the problem is defined as follows:

[tex](6m^5g^5)^2[/tex]

The power of a power rule is used when a single base is elevated to multiple exponents, and states that simplified expression is obtained keeping the base, while the exponents are multiplied.

Applying the exponent of 2, we have that:

6² = 36.5 x 2 = 10.

Hence the simplified exponential expression in the context of this problem is given as follows:

[tex](6m^5g^5)^2 = 32m^{10}g^{10}[/tex]

More can be learned about the power of a power property at brainly.com/question/11975096

#SPJ1

ہے
8. A randomized controlled trial was designed to compare the effectiveness of splinting versus
surgery in the treatment of carpal tunnel syndrome. Results are given in the table. The results
are based on evaluations made one year after the treatment. Using a 0.01 significance level,
find the test statistic and critical value needed to test the claim that the success is independent
of the type of treatment.
Splint treatment
Surgery treatment
Successful
Treatment
60
67
Otest statistic = 0.848, critical value = 6.635
statistic 9 750 critical value = 6.635
Unsuccessful
Treatment
23
6
(1 poir

Answers

The test statistic and critical value needed to test the claim that the success is independent of the type of treatment are 9.750 and critical value is 6.635.

How to calculate the value

The expected value for each cell is calculated as follows:

E = row total * column total / grand total

The grand total is 150.

The row totals are 83 and 67.

The column totals are 86 and 64.

The expected values are as follows:

Successful: 60 * 86 / 150 = 36.4

Unsuccessful: 60 * 64 / 150 = 29.6

Surgery treatment

Successful: 67 * 86 / 150 = 49.6

Unsuccessful: 67 * 64 / 150 = 27.4

The test statistic is calculated as 9.750

The critical value is calculated as follows:

α = 0.01

df = (r-1)(c-1) = (2-1)(2-1) = 1

x²(α, df) = 6.635

Learn more about statistic on

brainly.com/question/15525560

#SPJ1

What is the area of the rhombus? 25 mm2 33 mm2 50 mm2 100 mm2

Answers

The area of the rhombus is 100 mm². The Option D.

What is the area of the rhombus?

To get area of a rhombus, we will use the formula: Area = (d₁ * d₂) / 2 where d₁ and d₂ are the lengths of the diagonals.

Given that the horizontal diagonal length is 25 millimeters (d₁ = 25 mm) and the vertical diagonal length is 8 millimeters (d₂ = 8 mm.

We will substitute values into the formula:

Area = (25 mm * 8 mm) / 2

Area = 200 mm² / 2

Area = 100 mm².

Full question:

A rhombus with horizontal diagonal length 25 millimeters and vertical diagonal length 8 millimeters. what is the area of the rhombus? 25 mm2 33 mm2 50 mm2 100 mm2

Read more about rhombus;

brainly.com/question/28178503

#SPJ1

What is the value of x? Round to the nearest thousandth.

Answers

Applying the tangent ratio, the value of x in the image, rounded to the nearest thousandth is: 15.824.

How to Find the Value of x Using the Tangent Ratio?

The tangent ratio, commonly referred to as "tangent," is a trigonometric function that relates the ratio of the length of the side opposite an angle to the length of the side adjacent to that angle in a right triangle. It is expressed as:

tan (∅) = opposite/adjacent

We have the following:

Reference angle (∅) = 53 degrees

Length of opposite side = 21

Length of adjacent side = x

Plug in the values:

tan 53 = 21/x

x * tan 53 = 21

x = 21 / tan 53

x = 15.824

Learn more about Tangent Ratio on:

question

#SPJ1

A woman is selected at random from the population of the United States. Let event A represent "The woman is a professional basketball player" and event B represent "The woman is taller than 5 feet 4 inches."

Are these probabilities equal? If so, explain your reasoning. If not, explain which one is the greatest and why.

P(B) when you have no other information.

P(B) when you know A is true.

P(B) when you know A is false.

Answers

The probability of event B would likely be greater when event A is true, reflecting the tendency of professional basketball players to be taller.

To determine the probabilities in question, we need to consider the information provided and make some assumptions based on general knowledge about the population of the United States.

P(B) when you have no other information:

Without any other information, we cannot accurately determine the probability of event B, which represents "The woman is taller than 5 feet 4 inches." We would need additional data on the height distribution of women in the United States to calculate this probability.

P(B) when you know A is true:

If we know that event A is true, meaning "The woman is a professional basketball player," we can make some assumptions based on the nature of professional basketball players.

Generally, professional basketball players tend to be taller than the average population due to the physical requirements of the sport. Therefore, the probability of event B, "The woman is taller than 5 feet 4 inches," would likely be greater when we know event A is true.

P(B) when you know A is false:

If event A is false, meaning "The woman is not a professional basketball player," we cannot make any definitive conclusions about the probability of event B, "The woman is taller than 5 feet 4 inches." The height of an individual is not solely determined by their profession, so without further information, we cannot determine if event B is more or less likely when event A is false.

In summary, based on the given information, we can conclude that the probabilities of event B are not equal under different scenarios. The probability of event B would likely be greater when event A is true, reflecting the tendency of professional basketball players to be taller. However, without any other information, we cannot determine the probability of event B or make comparisons when event A is false.

Learn more about probability click;

https://brainly.com/question/31828911

#SPJ1

If s(x) = 2x² and f(x) = 3x, which value is equivalent to (s-f)(-7)?
O-439
O-141
O 153
O 443

Answers

The value of expression (s - f) (- 7) would be,

⇒ (s - f) (- 7)  = 119

We have to given that,

Functions are defined as,

⇒ s (x) = 2x²

⇒ f (x) = 3x

Now, We can find the value of (s - f) (- 7) is,

⇒ (s - f) (- 7)

⇒ s (- 7) - f (- 7)

⇒ 2 (- 7)² - (3 × - 7)

⇒ 2×49 + 21

⇒ 98 + 21

⇒ 119

Therefore, The value of expression (s - f) (- 7) would be,

⇒ (s - f) (- 7)  = 119

Learn more about the function visit:

https://brainly.com/question/11624077

#SPJ1

100 Points! Geometry question. Photo attached. Find the measure. Please show as much work as possible. Thank you!

Answers

Answer:

The answer would lie within 31 degrees of MP and also as in PM.

Answer:

central m arc MP=118°

Step-by-step explanation:

here

central m arc MN=2* inscribed m arc MN=2*31=62°

again

central m arc MN+ central m arc MP=180° being linear pair

substituting value

62°+central m arc MP=180°

central m arc MP=180°-62°

central m arc MP=118°

The box contains some green and yellow counters. 7/4 of the box is green counters. There are 24 yellow counters . How many green counters are there?

Answers

Considering the definition of an equation and the way to solve it, there are 84 green counters in the box.

Definition of equation

An equation is the equality existing between two algebraic expressions connected through the equals sign in which one or more unknown values appear.

The solution of a equation means determining the value that satisfies it. To solve an equation, keep in mind:

When a value that is adding, when passing to the other member of the equation, it will subtract.If a value you are subtracting goes to the other side of the equation by adding.When a value you are dividing goes to another side of the equation, it will multiply whatever is on the other side.If a value is multiplying it passes to the other side of the equation, it will pass by dividing everything on the other side.

Amount of green counters

Knowing that:

7/9 of the box is green counters.1-7/9= 2/9 of the bok are yellow counters.There are 24 yellow counters.

the equation in this case is:

2/9 × total counters on the box =24

Solving:

total counters on the box =24÷ 2/9

The first step in dividing by a fraction is to find the reciprocal (reverse the numerator and denominator) of the second fraction.

Then, the two numerators and the two denominators must be multiplied and, if necessary, the fractions are simplified.

total mountain bikes =24× 9/2= 24/1× 9/2

total mountain bikes =(24×9)/ (1×2)

total mountain bikes =216/2

total mountain bikes =108

Then, there are 108 green and yellow counters in the box.

So, the amount of green counters in the box is calculated as:

Amount of green counters= 7/9× 108

Amount of green counters= 7/9× 108

Amount of green counters= 84

Finally, there are 84 green counters in the box.

Learn more about equations:

brainly.com/question/4983716

#SPJ1

A circle is inscribed inside a square of a side length of 10 cm. What is the area inside the square and outside the circle

Answers

Answer:

The figure is omitted--please sketch it to confirm my answer.

[tex]\pi {(5 \sqrt{2}) }^{2} - {10}^{2} [/tex]

[tex]50\pi - 100 = 50(\pi - 2) = 57.08[/tex]

The area inside the square and outside the circle is about 57.08 cm^2.

Enter the number that belongs in the green box

Answers

The number in the green box is 31.78° .

Given,

Triangle with sides 11 , 12 , 20.

From Cosine Law.

Let △ABC have sides a, b,  c.

Here,

a = 11

b = 20

c = 12

Length of the side opposite vertex A is called a.

Length of the side opposite vertex B is called c.

Length of the side opposite vertex C is called c.

Let θ = ∠C

Then, the Cosine Law says that

c²=a²+b²−2abcosθ.

Substitute the values of a , b , c .

12²  = 11² + 20² - 2 × 11× 20 cosθ

θ = 31.78°

Hence the angle can be found out from cosine law.

Learn more about Triangles laws,

https://brainly.com/question/20345865

#SPJ1

Please help i will give brainliest

Answers

The value of measure of angle 1, angle 2, and angle 3 are,

⇒ ∠1 = 106 degree

⇒ ∠2 = 74°

⇒ ∠3 = 74°

We have to given that;

Angle in figure is,

⇒ 74°

Since, From figure,

angle 1 is,

⇒ ∠1 = 180 - 74

⇒ ∠1 = 106 degree

Hence, We get;

Measure of angle 2 is,

⇒ ∠2 = 180 - 106

⇒ ∠2 = 74°

And, Measure of angle 3 is,

⇒ ∠ 3 = ∠ 2

By definition of alternate interior angle.

⇒ ∠3 = 74°

Learn more about the angle visit:;

https://brainly.com/question/25716982

#SPJ1

The measure of ∠1 is 106 because it is a straight angle with 74° angles.

The measure of ∠2 is 74 because it is a vertical angle with 74° angles.

The measure of ∠3 is 74 because ∠3 and 74° are corresponding angles.

We have,

The angles that are in the same position on a given two parallel lines intersected by a transversal line are called the corresponding angles.

Corresponding angles are always equal.

Now,

∠1 + 74 = 180

∠1 = 180 - 74

∠1 = 106

And,

∠2 and 74 are vertical angles.

So,

∠2 = 74

And,

∠3 and 74 are corresponding angles.

So,

∠3 = 74

Thus,

The measure of ∠1 is 106 because it is a straight angle with 74° angles.

The measure of ∠2 is 74 because it is a vertical angle with 74° angles.

The measure of ∠3 is 74 because ∠3 and 74° are corresponding angles.

Learn more about corresponding angles here:

https://brainly.com/question/1597341

#SPJ1

Find the x-intercept and the y-intercept of the line below. Click on "None" if applicable.
6543/2
-24
1-3-
J
ہے

Answers

Answer:

(a) x-intercept = -2

(b) y-intercept = 4

two rectangles have the same base lengths. one rectangle has a height that is twice the height of the other rectangle. are the heights and areas proportional

Answers

Although the rectangles have the same base lengths, the heights and areas are not directly proportional in this case.

Are the heights and areas of the rectangles proportional?

Let's denote the base length of both rectangles as 'b'. If one rectangle has a height that is twice the height of the other rectangle, we can denote the heights as 'h' and '2h', respectively.

The area of a rectangle is calculated by multiplying the base length by the height. Therefore, the area of the first rectangle with height 'h' would be A₁ = b * h, and the area of the second rectangle with height '2h' would be A₂ = b * (2h) = 2b * h.

Comparing the two areas, we have A₁ = b * h and A₂ = 2b * h. It is evident that the areas are not proportional because the area of the second rectangle is twice the area of the first rectangle.

learn more on area of rectangle here;

https://brainly.com/question/25292087

#SPJ1

Use a table of values to graph the following exponential function. (see attachment)

y= 2^x

Please graph

Answers

By using the table of values, a graph of the exponential function is shown in the image below.

What is an exponential function?

In Mathematics and Geometry, an exponential function can be modeled by using this mathematical equation:

[tex]f(x) = a(b)^x[/tex]

Where:

a represents the initial value or y-intercept.x represents x-variable.b represents the rate of change, common ratio, decay rate, or growth rate.

Based on the information provided above, we can logically deduce the following exponential function;

[tex]y = 2^x[/tex]

Next, we would create a table of values based on the exponential function;

when x = 0, the y-value is given by;

y = 2⁰

y = 1

when x = 1, the y-value is given by;

y = 2¹

y = 2

x                     y____

-2                 0.25

-1                  0.5

0                   1

1                    2

2                   4

Read more on exponential functions here: brainly.com/question/28246301

#SPJ1

Other Questions
a depreciation of the real exchange rate in a small open economy could be the result of: a domestic tax cut. an increase in government spending. a decrease in the world interest rate. the expiration of an investment tax-credit provision. canyou please answer question 5 and 6Question 5 0/1 pt 319 Details Find the volume of the solid obtained by rotating the region bounded by y = 6x, z = 1, and y = 0, about the 2-axis. V Question Help: Video Submit Question Question 6 0/ Which statement accurately describes Kublai Khan?He conquered China and then rebuilt the country's war-ravaged infrastructure.He relied on Chinese advisors, rather than Mongols from his own tribe, to help him rule.He closed off China from all contact with foreigners during his reign.He was poisoned by his half-brother, Genghis Khan, and died at the age of 34. Calculate VaR and expected shortfall (Part 2): Suppose that each of two investments has a 3% chance of a loss of $10 million, a 7% chance of a loss of $3 million, and a 90% chance of a profit of $2 million. They are independent of each other. What is the VaR for a portfolio consisting of the two investments when the confidence level is 95%? Select one: O a $20 million O b. $13 million Oc. $8 million O d. $6 million Oe. $3 million two oscillating systems that you have studied are the block-spring and the simple pendulum. there is an interesting relation between them. suppose that you have a weight on the end of a spring, and when the weight is in equilibrium, the spring is stretched a distance h. show that the frequency of this block-spring system is the same as that of a simple pendulum whose length is h. dy 1/ 13 Find if y=x dx dy II dx (Type an exact answer.) Using the information below, calculate net cash flows from operating activities: B ZAB Net income Receive cash from issuing stock Pay cash for equipment Increase in accounts receivable Depreciation expense Increase in accounts payable Receive cash from sale of land Pay cash dividends $120,000 80,000 90,000 10,000 $ 30,000 5,000 75,000 20,000 Multiple Choice $190,000 $155,000 Multiple Choice $190,000 $155,000. $145,000 $115,000. For 127 consecutive days, a process engineer has measured the temperature of champagne bottles as they are made ready for serving. Each day, she took a sample of 5 bottles. The average across all 635 bottles (127 days, 5 bottles per day) was 54 degrees Fahrenheit. The standard deviation across all bottles was 1.1 degree Fahrenheit. When constructing an X-bar chart, what would be the center line? x? - 3x + 2 Find the limits in a) through c) below for the function f(x) = Use -oo and co when appropriate. x+2 a) Select the correct choice below and fill in any answer boxes in your choice. OA. lim If you omit the size declarator when you define an array, you must a. set the size before you use the array b. use an initialization list so the compiler can infer the size c. assign a value to each element of the array that you want to create d. copy elements from another array Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3' where can you obtain additional information about the danb examinations The two most important aspects of one's emotional intelligence are:a) the ability to out-wit my supervisor and competitiveness.b) self-awareness and empathy.c) stubbornly sticking to my own perspective and the inability to feel for the positions my co-workers are in.d) intellectual capacity and business acumen. consider f and c below. f(x, y, z) = (y2z 2xz2)i 2xyzj (xy2 2x2z)k, c: x = t , y = t 7, z = t2, 0 t 1 1. A ladder is propped up against a wall, and begins to slide down. When the top of the ladder is 15 feet off the ground, the base is 8 feet away from the wall and moving at 0.5 feet per second. How far it s? please help me solvethis!6. Find the equation of the parabola with directrix at y = -2 and the focus is at (4,2). The U.S. Census Bureau reported that the mean area of U.S. homes built in 2012 was 2505 square feet. A simple random sample of 15 homes built in 2013 had a mean area of 2645 square feet with a standard deviation of 240 feet. Can you conclude that the mean area of homes built in 2013 is greater than the mean area of homes built in 2012? It has been confirmed that home sizes follow a normal distribution. Usea 10% significance level.Round your answer to four decimal places. Gravity causes the pressure in the ocean to vary with depth. True or False? explain the different challenges that each trench belt created. here's our first in-lecture quiz. what is one way erikson's theory differs from freud's theory?