What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

Answer 1

GTTCAAGCTACTGTTCAAGCTACT


Related Questions

Describe the role of ATP and enzymes in the underlying molecular processes, including what happens to the free energy of some of the molecules involved.

Answers

Answer:

Role of ATP and enzymes are very important.

Explanation:

The role of ATP and enzymes are very important in the process of digestion because enzyme speedup the chemical reaction such as digestion without using in it and when the break down of micromolecules such as glucose occurs, energy is produces in the form of adenine tri phosphate (ATP) that is used in different activities whereas the free energy of some molecule is utilized in doing some useful work.

How do scientists say the melting ice can contribute to disease occurrence? Also example

Answers

Answer:

In the melting of icebergs, icebergs could potentially contain long-dormant bacteria and viruses. Those viruses trapped in ice and permafrost for centuries, can be reactivated. That means melting those ice could potentially open a Pandora's box of diseases.  Including some that have caused global epidemics in the distant past.

Example: babesiosis

As of regular ice. The freezing of bacteria in water isn't just an old practice and ice from unclean sources could also contain disease, when melted and ingested or touched this ice as well could transmit disease not so long-dormant, however still unpleasant.

Example: AIDS

during photosynthesis, what is the source of the carbon i the sugar that is created

Answers

Answer:

Plants get the carbon from the air that humans exhale. They breath it in and use it for photosynthesis.

Explanation:

Took biology last year.

During photosynthesis, what is the source of the carbon is the sugar that is created is carbon dioxide in the air.

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.Carbon dioxide serves as the source of carbon, and it enters the photosynthetic process in a series of reactions called the carbon-fixation reactions (also known as the dark reactions).

Stages of photosynthesis:

(i) Absorption of light energy by chlorophyll.

(ii) Conversion of light energy to chemical energy and splitting of water molecules into hydrogen and oxygen.

(iii) Reduction of carbon dioxide to carbohydrates.

Learn more:

brainly.com/question/9498584

WHICH LEVEL OF PROTEIN STRUCTURE MUST BE INVOLVED IN FORMING THE ACTIVE SITE

Answers

Answer:tertiary and quaternary

Explanation:

What gases are responsible for most of the pressure exerted by the atmosphere on the surface of Earth?

Answers

Answer:

nitrogen and oxygen

Explanation:

volume makes up less than %1

The gases that contribute most to the atmospheric pressure are required.

The gases which exert the most pressure on the surface of Earth are nitrogen and oxygen.

The composition of gases present in the atmosphere of Earth is

Nitrogen [tex](N_2)[/tex] = 78.084%

Oxygen [tex]O_2[/tex] = 20.946%

Other gases = 0.97%

The other gases include carbon dioxide, argon, neon, helium, methane, hydrogen and krypton.

So, the gases which exert the most pressure on the surface of Earth are nitrogen and oxygen.

Learn more:

https://brainly.com/question/9147342

https://brainly.com/question/3574362

simply means lessen the use of unnecessary materials

Answers

Answer:

ok

Explanation:

okokokokokokokkokokok0k0k

Reduce: simply means lessen the use of unnecessary materials.

Waste management can be defined as the processes, schemes, activities and actions that are typically required to collect, treat and manage (handle) a waste material from its creation to its final disposal.

Basically, some importance of waste management are:

I. It makes planet Earth free from garbage or waste materials.

II. It promotes a clean, beautiful and healthful environment.

III. It helps to transform garbage or waste materials into something useful through recycling.

The 5Rs of waste management generally refers to an efficient, effective and modern way of managing garbage and waste material, these include:

Refuse.Reduce.Reuse.Repurpose.Recycle.

Reduce is a waste management technique which involves lessening the use of unnecessary materials in the performance of a task.

For example, biodegradable materials can be burned to lessen waste.

Read more: https://brainly.com/question/18769370

What conclusion is best supported by the selection above ? NUMBER 2

Answers

Answer:

Arginine and Lysine play same role in membrane proteins.

Explanation:

The scientist have tested Lysine and Arginine to get information about their properties. The test lead to conclusion that both are amino acids which are high in aqueous values which lead to high electrostatic interaction. These amino acids play important role in membrane proteins.

PLEASE HELP I HAS 5 MINUTES

Answers

Answer:

its ethier a or c

Explanation:

Impetigo.

Explanation....

It cannot be acne since this occurs when you are more in the teens and is not yellow, eliminate the last one.

It cannot be ringworm because they are worms and not apperanced by yellow crust, eliminate the second one.

It cannot be eczema since this is red not yellow, eliminate the first one.

Impetigo appears as yellow crust. Therefore, your answer is the third one, Impetigo.

Light behaves in specific ways. It can be reflected, refracted, or absorbed, and under certain conditions, run into different kinds of interference. Which explanation best describes why light is refracted as it enters water?


A. The light bends when it enters water due to its reflection.

B. The speed of light remains the same as it moves from air to water, causing the light to reflect.

C. The speed of light increases when it enters a different medium, but it doesn't bend.

D. The speed of light changes as it moves from air to water, causing the light to bend.

Answers

Answer:

D

Explanation:

Refraction is generally defined as the change in the direction of a wave as it travels from one medium to another. Light is a form of wave and light refraction is caused by a change in the speed of light as it moves from air to water, causing the light to bend in the process. The medium of travelling has to be transparent.

The change in the speed and direction is due to the variability in the refractive index of media. Light travels faster as it moves from a medium of higher refractive index to a medium of lower refractive index and vice versa.

The correct option is D.

Use your own observations and real-life experiences about your brain​

Answers

Answer:

our life experience changes our brain so if u fall off a bike ur brain will train u and send signals to ur body ur brain also knows when its forgetting something but doesn't know what its forgetting

Explanation:

In physics, what is a black body?

Answers

Answer:

Blackbody, in physics, a surface that absorbs all radiant energy falling on it. The term arises because incident visible light will be absorbed rather than reflected, and therefore the surface will appear black. The concept of such a perfect absorber of energy is extremely useful in the study of radiation phenomena.

The football team has a total of 25 jerseys . There are 5 mediums-sized jerseys . What percent of the Jerseys are médium-sized Jersey?

Answers

Answer:

20% or 0.2

Explanation:

if u divide 5 by 25, u get 0.2, which in decimal form is 20%

Largest layer of earth that makes up most of the earths mass. A:crust B:mantle. C:outer core. B:inner core

Answers

Answer:

Mantle is the answer

Explanation:

The Earth can be divided into four main layers: the solid crust on the outside, the mantle, the outer core and the inner core. Out of them, the mantle is the thickest layer, while the crust is the thinnest layer.

I am taking the same class rn!!! whos your teacher??

Answer:

b-MANTLE

Explanation:

The mantle is the mostly-solid bulk of Earth's interior. The mantle is about 2,900 kilometers (1,802 miles) thick, and makes up a whopping 84% of Earth's total volume.

in which two steps of cellular respiration is the co2 produced

Answers

Answer:The only difference between a molecule of a compound and a molecule of an element is that in a molecule of an element, all the atoms are the same. For example, in a molecule of water (a compound), there is one oxygen atom and two hydrogen atoms. But in a molecule of oxygen (an element), both of the atoms are oxygen.

Explanation:hope this helps

Which of these is describing a Eutrophic Lake?

Mucky Water
Cold Water
Low Biodiversity
Rocky Bottomed

Plz answer I need help thank you

Answers

Answer:

Mucky water and rocky bottom

Answer:

mucy water ..........

Man made sources of green House Gases

A
Factory emmissions

B
all of them

C
Chlorofloro Carbons

D
Automobile emmissions

Answers

Answer: C. Chlorofluoro Carbons.

How is cellular respiration
connected to our muscular
system?

Answers

Answer:

Cellular respiration is a key role in returning the muscles to normal after exercise, converting the excess pyruvate into ATP and regenerating the stores of ATP, phosphocreatine, and glycogen in the muscle that are required for more rapid contractions.

Hope that helps!

How the coin flip relates to the probability of inheriting genetic condition?

Answers

Answer:

A coin represents a diploid, heterozygous cell with its heads and tails sides. The act of tossing the coin to land on heads or tails, provides an apt representation of the segregation of alleles during meiosis in the formation of gametes.

or i guess you could just say its all by chance ;P

peace :)

Answer:

It is very similar to the way traits are inherited in nature, as both combinations occur by chance. Though, in the coin toss, there are only 2 possible alleles whereas in nature there may be more complicated combinations of alleles for traits.

Explanation:

The hydrogen used to produce ATP in the light reactions of photosynthesis comes from ___.
a. Splitting water
b. Carbon fixation
c. Movement of hydrogen ions through the membrane
d. The burning of sugar molecules

Answers

Answer:

c.

Explanation:

An aquarium with a glass lid is an example of an isolated system.

true
false

Answers

Answer:

The answer is false!

Explanation:

I took the K12 science quiz.  I hope this helps! Have a blessed day! :)

The statement "An aquarium with a glass lid is an example of an isolated system" is false as light, air, and heat can transfer through the glass lid.

What is an aquarium?

An aquarium is an artificial place that is made for putting fish and other water animals in houses buildings and other places. Aquariums are made up of glass so can we, so we can see the fish's aquarium also have oxygen pumps the water also changed in the aquarium from time to time and. The aquarium is kind of decorative.

Aquariums are made up of glass, and they are open from the top so that fish can get air.

An aquarium is not an isolated system as light year and heat can transfer through the top and fishes are living organisms that need an open system to breathe and live.

Therefore, the statement is false.

To learn more about aquariums, refer to the below link:

https://brainly.com/question/21337200

#SPJ5

5.2 learning the key term answer

Answers

What’s the question your asking ?

Herbicides are being used to kill weeds in a nearby field. The plants absorb the herbicides from the soil. Which organelle
in the plant will most likely store the absorbed herbicide waste?
ribosome
vacuole
chloroplast
mitochondrion

Answers

Answer:

The answer is B. Vacuole

Explanation:

As the plants have no used for the herbicides, it will be transported to it "waste bin" which is the Vacuole.

Definition of Vacuole: Vacuoles are generally small and help sequester waste products. In plant cells, vacuoles help maintain water balance. Sometimes a single vacuole can take up most of the interior space of the plant cell.

Also, completed a test with same question, and got it right.

Vacuole organelle in the plant will most likely store the absorbed herbicide waste.

What is Vacuole?

Animal, plant, bacterial, protist, and fungal cells all include vacuoles. It has the size of a giant sac and is one of the biggest organelles found in cells.

Vacuoles are bordered by a thin membrane and filled with fluid and any molecules they take in.

This is their basic structure. Because both are membrane-bound sacs, they resemble another organelle called vesicles, however vacuoles are substantially bigger than vesicles and are created when numerous vesicles fuse together.

Therefore, Vacuole organelle in the plant will most likely store the absorbed herbicide waste.

To learn more about Vacuoles, refer to the link:

https://brainly.com/question/31254518

#SPJ5

PLEASE HELPP!!!!

Describe the water cycle in a brief paragraph. Use terms that you know are associated with the water cycle.

Answers

Answer:

The water cycle or hydrologic is a continuous cycle where water evaporates, travels into the air and becomes part of a cloud, falls down to earth as precipitation, and then evaporates again. ... As clouds move up and over mountains, the water vapor condenses to form precipitation and freezes.

summer squash purchased at your local grocery store would be biologically classified as a

Answers

Answer:

considered a vegetable.

Explanation:

The diagram below shows the exchange of carbon dioxide (CO2) and oxygen (O2) between a cell and the blood flowing through a capillary.


In this diagram, the molecules of CO2 (represented by x’s) are moving from an area of--

Answers

Answer:

From an area of higher concentration to an area of lower concentration.

Explanation:

The molecules of CO2 are moving from an area of higher concentration to an area of lower concentration. Carbondioxide is produced as waste product in the cell during the process of respiration. This carbondioxide gas is loaded in blood cells because in the cell, concentration of carbondioxide gas is higher while on the other hand the concentration of carbondioxide is lower in the blood cells. This carbondioxide gas exchange in the lungs with oxygen which is required in the process of respiration for the production of energy in the form of ATP molecules. So from the conclusion we can say that CO2 moves from an area of higher concentration to lower concentration.

What type of radiation constitutes the basis for setting an SPF rating?

p

Answers

Answer:UV radiation

Explanation:

PLEASE HELP!

1. How does a clock and its internal and intricate mechanical parts make up a system(Explain)


2. Is it a living or nonliving system? (Explain)


3. How may it support a living system? (Explain)


4. Therefore what is an good example of a definition of a system?

Answers

Answer:

1. A clock with internal mechanical parts comprises a system because it is a combination of various parts that a heterogeneous in nature and function working together to achieve one end - indicating the time accurately.

Some mechanical clocks comprise of at least 10 parts namely:

Gear train: This component alone is a sub-system that comprises of at least 8 parts. These parts are broadly classified into wheels, pinions, and barrels.Main SpringPalletEscapement Escapement WheelBarrell Barrell WheelBalance Spring etc

2. A clock is a non-living system.

Living systems have certain characteristics. Some of them are:

Stimuli: Response to the environmentGrowth and development: The are able to increase in size and dimensionsHomeostasis: this is the capability of self-regulation regardless of external conditions such as temperature and pressure.   etc

3. A cannot support a living system. It can however help a human being (which is essentially a combination of various systems) to tell the time.

4. a system is a combination of heterogeneous parts that work in unison to form a whole complex entity that can perform one or more functions.

Cheers

When testing tonicity of red blood cells, if the solution became opaque after adding blood cells, you could assume

Answers

Answer:

The solution was hypertonic and that the cells had burst.

Explanation:

When testing tonicity of red blood cells, if the solution became transparent after adding blood cells, you could assume the solution was hypotonic and the cells had burst.

Tonicity of the red blood cells is the degree or measure of the red blood cells ability to change the volume of a cell by alternating water amount.

From the above we can therefore say that the answer When testing tonicity of red blood cells, if the solution became transparent after adding blood cells, you could assume the solution was hypotonic and the cells had burst is correct

learn more from:

https://brainly.com/question/19259559

The process by which animals use oxygen to convert food to energy is called

Answers

Answer:

Respiration

Explanation:

Respiration is the process by which animals use O2 to get energy from food. So plants take in CO2 from the air and produce O2, and animals take in O2 from the air and produce CO2

Which is required for the light-independent reactions in photosynthesis to occur?
wo

Answers

Answer: require light energy and water, and the L-IND reactions require ATP, NADPH and CO2.

Explanation:

Other Questions
Ojal que ustedes ___________(divertirse ) Deseamos que nuestros padres no nos____________ (exigir ) Plz put in subjunctive tense thanks!!! The new number, 550, is 200 more than the original number. What is the approximate percent change?The percent change is approximately 33%.The percent change is approximately 55%.The percent change is approximately 150%.The percent change is approximately 175%. Please anybody please Mesopotamia, Nile River Valley, Indus River Valley, Huang He River Valley civilizations all had? Which of the processes offers the GREATEST evolutionary advantage of sexual versus asexual reproduction?meiosisB mitosisbuddingDbinary fission Should the people who created the new policy of separating families when someone crossed the US border without proper paperwork, even ifthey were asking for amnesty, be held accountable?In other words, should the people who made this new rule have to face punishment for taking children from their parents and keeping them inthe US while their parents cannot be located? (Read the article but some of these children have been separated from their parents for TWOyears.)ORIs it the parents fault for coming here expecting amnesty or without proper paperwork and there should be no punishment of US officials whocreated this policy?Search entries or authorUnreadReplyReplies are only visible to those who have posted at least one reply. f) graph the function in part e. (10 points) Today we analyzed five different problems the United States faced now that they are a new young independent nation. Which of the five categories of problems we studied today do you think would be the most difficult for America to solve? Why? What are the best keyboard switches?I'm building a mechanical keyboard and what switches should I order? Four workers are repairing a bridge. Show the workers locations from highest to lowest position in relation to the roadway. worker 1 is 7 feet below the roadway worker 2 is 10 feet above the roadway worker 3 is 10 feet below the roadway worker 4 is standing on the roadway I GIVE 10 POINTS ! + 5PLEASE HELP PLEASE HELPSolve for the value of x. According to the information above the Magna Carta most influenced the colonial development of-A)federalism B)judicial reviewC)federalism D)representative government Giuseppe and I held tightly to Stepfather's hands, while Liberta and Helvetia clung to Mother. Passengers all about us were crowding against the rail. Jabbered conversations, sharp cries, laughs and cheers -- a steadily rising din filled the air. Mothers and fathers lifted up babies so that they too could see, off to the left, the Statue of Liberty.It was noisy on the ship sailing to America. Immigrant parents and children made a lot of noise, especially when they got to the Statue of Liberty.Immigrant families sailing to America were excited when they finally made it to the New York harbor. Everyone on board made happy noise as they reached the United States.Everyone on board the ship was fighting to see the Statue of Liberty. Babies and mothers and fathers all cried because they couldnt see it, because it was off to the left.Immigrant children had to hold tightly to their parents hands. There was so much crowding and jostling on board the ship. If they didnt stay close to their parents, they would fall off the boat.Mark this and return. in one sense the animal classification system above the species level is artiffical. In another sense, however, it is real explain the paradox critique metaphysics as a branch of philosophy 2. Were those initially accused among those most capable of defending themselves in Salemsociety?Please help!!! Which number has the lowest value?A1/5B0.25C0.21D1/3 PLEASE HELP ME!Choose the scenario that could be represented by 3/8A. a three-foot submarine sandwich is cut into eight equal portionsB. an eight-hour trip is decided into three equal legs.C. eight cups of milk are fed to three cats equallyD. an eight-foot wooden board is cut into three equal pieces -74.25That the right answer She was standing at the museum entrance, way at the top of the steps, gesturing impatiently at me to come on. (page 10) What does the word impatiently mean? *25 pointsTo be able to waitArguing; to challengeTo be unable to wait; missing patienceScreaming; to yell