What is the length of the segment shown below. Round your answer to the nearest hundredth. (2,5) (-4,-1)

Answers

Answer 1

Answer:

Step-by-step explanation:

use the distance formula Emily  P1=(x1,y1)=(2,5) P2=(x2,y2)=(-4,-1)

d = [tex]\sqrt{(x2-x1)^{2}+ (y2-y1)^{2} }[/tex]

d = [tex]\sqrt{6^{2}+ 6^{2} }[/tex]

d = 8.48528

d  = 8.49


Related Questions

Use the rules of significant figures to answer the following question:

54.313 × 12.09

A. 657

B. 660

C. 656.64

D. 656.6​

Answers

the answer is C. 656.64

A $96.00 item is marked down by 25%
what is the new cost of the item?
round if needed

Answers

Answer:

$72.00

Step-by-step explanation:

Answer:

$72

Step-by-step explanation:

25% of $96 = [tex]\frac{25}{100}[/tex] × [tex]\frac{96}{1}[/tex]  [tex]\frac{25}{100}[/tex] × [tex]\frac{96}{1}[/tex] = [tex]\frac{2400}{100}[/tex]  [tex]\frac{2400}{100} = 24[/tex]  $96 - $24 = $72

I hope this helps!

Find the unit tangent vector at the given value of t for the following parameterized curves.

r(t)= ⟨7–√e^t,3e^t,3e^t⟩

, for 0≤t≤1
; t=ln 2

Answers

Answer:

[tex]T(ln2)[/tex][tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

Step-by-step explanation:

Given : [tex]r(t)=<7-\sqrt{e^t}, 3e^t,3e^t > .........(i)[/tex]

We first have to differentiate of equation [tex](i)[/tex]

[tex]r'(t) = < \frac{\sqrt{e^t} }{2} , 3e^t,3e^t> ..........(ii)[/tex]

Now to get a unit tangent vector at the given value of [tex]t[/tex], we put [tex]t = ln2[/tex] in equation [tex](ii)[/tex]

[tex]r'(ln2) = < \frac{\sqrt{e^{ln2}} }{2} , 3e^{ln2},3e^{ln2}>[/tex]

            [tex]= <\frac{1}{\sqrt{2} } ,6,6>[/tex]        [∵[tex]e^{lna}=a[/tex]]

Now to get a unit tangent vector , we will divide our vector [tex]r'(ln2)[/tex] by its magnitude. So let's first find the magnitude.

[tex]|r'(ln2)|=\sqrt{(\frac{1}{\sqrt{2} } )^2 +6^2+6^2}[/tex]

             [tex]= \sqrt{\frac{1}{2}+36+36 }[/tex]

             [tex]= \sqrt{\frac{145}{2} }[/tex]

Now we can find the our unit tangents vector.

      [tex]T(ln2)=\frac{r'(ln2)}{|r'(ln2)|}[/tex]

                  [tex]= \frac{<\frac{1}{\sqrt{2}} ,6,6> }{\sqrt{\frac{145}{2}} }[/tex]

                  [tex]= <\frac{\frac{1}{\sqrt{2} } }{\sqrt{\frac{145}{2}} } ,\frac{6}{{\sqrt{\frac{145}{2}} }}, \frac{6}{{\sqrt{\frac{145}{2}} }} >[/tex]

                   [tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

Hence, [tex]T(ln2)[/tex] [tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

The function f(x) = -square root x is shown on the graph.
Which statement is correct?
ТУ
7
6
5
3
The domain of the function is all real numbers less
than or equal to - 1
O The range of the function is all real numbers greater
than or equal to 0.
The range of the function is all real numbers less
than or equal to 0.
The domain of the function is all real numbers less
than or equal to 0.
2
55
14
-
2
-
3
4 5 6 7 X
-2
3
4
-5
-6

Answers

Answer:

O The range of the function is all real numbers greater

than or equal to 0.

Step-by-step explanation:

The function f(x) = -square root x is shown on the graph.

Which statement is correct?

ТУ

7

6

5

3

The domain of the function is all real numbers less

than or equal to - 1

O The range of the function is all real numbers greater

than or equal to 0.

The range of the function is all real numbers less

than or equal to 0.

The domain of the function is all real numbers less

than or equal to 0.

2

55

14

-

2

-

3

4 5 6 7 X

-2

3

4

-5

Answer:

C:domain: all real numbers

range: all real numbers greater than 1

Step-by-step explanation:

Edge 2021

For which line is the slope least?

Answers

I would definitely that the

i need help pls help me

Answers

Answer:

yes

Step-by-step explanation:

Answer:

18

Step-by-step explanation:

you have to multiply 2/3 by 27 km

is the product of 18 negative numbers and 20 positive numbers a positive number or negative

Answers

Answer:

positive

Step-by-step explanation:

even negatives = positive

whatever positives = positive

positive*positive = positive

What is the common factor of 26 and 38

Answers

Answer: The GCF is 2 and the LCF is 1

Step-by-step explanation:

the height of 12 students
are as below &
159, 148, 138, 150, 165, 166, 145, 152 155 160 147, 151
the mean, the median and the mode​

Answers

Answer:

Mean = 153

Median = 151.5

Mode = 159, 148, 138, 150, 165, 166, 145, 152, 155, 160, 147,

Step-by-step explanation:

Mean - add all numbers up (1820) then divide by 12

Median - put numbers in order, add two middle numbers and divide by 2

Mode - each number only came up once so they are all the mode

WILL GIVE BRAINLIEST

Find the equation of the line

perpendicular to y=-2x + 1 that

also intersects the point (8, 2).

y- Hx+ 1

Enter

Answers

Answer:

y=1/2x-2

Step-by-step explanation:

perpendicular lines have a neg. reciprocal for the slope.

for example:

in this equation y=-2x+1

-2 is the slope and the negative reciprocal would be 1/2

hence, the slop of our new line is 1/2

y=1/2x+b

we can substitute the coordinates given for x and y:

2=1/2(8)+b

2=4+b

-2=b

hence the new equation is y=1/2x-2

Easy 3 questions but I’m dum

Answers

Try adding them up and finding the total then see which is the part you need compared to the whole

find the slope thanks ​

Answers

Answer:

Hello! Just here so the other person can get brainliest. I will do the same for the other questions.

Step-by-step explanation:


does anyone know this please help

Answers

Answer:

It is the 3rd graph

Step-by-step explanation:

It is the only one that shows a porpotional relationship.

Answer:

sry mate.....

............

W + 7 < 4 you don’t have to show work

Answers

W < -3
Subtract 7 from both sides

Find all solutions in the interval [0, 2pi).
tanx+ secx =1
a) x=pi/4
b) x=0
c) x=5pi/4
d) no solution

Answers

Answer:

1 should be the answer bi

Step-by-step explanation:

Which set of side lengths form a right triangle?
2 inches, 3 inches, 4 inches
6 inches, 8 inches, 10 inches
8 inches, 9 inches, 11 inches
10 inches, 12 inches, 13 inches

Answers

Answer:

It’s 10 inches, 12 inches, 13 inches

Step-by-step explanation:

mang pedro has 20 kilogram of rice.he will repack it in 1/2 kilograms per bag.how many bags will he need?​

Answers

Answer:

40

Step-by-step explanation:

20 x 2 because you will need 2 bags per kg

Can someone please help

Answers

Answer:20 minutes

Step-by-step explanation:

It would be 20 because 55+5= 60 which is an hour and then 5+15=20

Hope this helps

Have a great day/night

A community garden center host a plant giveaway every spring to help community members start there gardens. Last year the give away supported 50 families by giving away 150 plants. Based on this ratio hawa many plants will they give away this year in order to support 65 families

Answers

Answer:

195 plants (verified) ✅

Step-by-step explanation:

We will use a proportion to solve this.

x/y = x/y

let x = the number of families in each case

let y = the number of plants in each case

Since we don't know the second y, we will leave that as y and solve for it.

50/150 = 65/y

Cross-multiply

50y = 9750

Divide

195  = y

Now, we can check this by substituting the value of y back into the equation and seeing if both sides equal.

50 (195) = 9750

9750 = 9750 ✅

I need help...



Please help to find ...​

Answers

Answer:

NEED TO FIND WHAT

Step-by-step explanation:

The height of the tunnel at the center is 35ft, and the vertical clearance must be 21 ft at a point of 8ft from the center. Find an equation for the parabola.


INCLUDE WORK.

Answers

Answer:

y=-0.215x^2+35

Step by Step:

Let, [tex]h=0[/tex],  [tex]k=35[/tex], [tex]x=8[/tex], [tex]y=21[/tex]

We know that, the general equation of the parabola.

   [tex]y-k = a(x-h)^2[/tex]

[tex]\Rightarrow y=a(x-h)^2+k .........(i)[/tex]

Substitute the  value of [tex]h, k, x, y[/tex] in equation [tex](i)[/tex] and find the value of [tex]a.[/tex]

  [tex]21=a(8-0)^2+35[/tex]

[tex]\Rightarrow 21=a\times 8^2+35[/tex]

[tex]\Rightarrow 21=64a+35[/tex]

[tex]\Rightarrow 64a=21-35[/tex]

[tex]\Rightarrow 64a=-14[/tex]

[tex]\Rightarrow a=\frac{-14}{65}[/tex]

[tex]\Rightarrow a=-0.215[/tex]

Hence, the equation of the parabola is:

[tex]y=-0.215x^2+35[/tex]

Which pair of expressions is equivalent? 2(x + 5) and 2x + 10 B. 3x – 6 + 4x + 9 and 7x + 15 0. C. 4y - 2) and 4y - 2 0 D. 5y + 12 - 3y and 2y – 12​

Answers

Answer:

A

Step-by-step explanation:

the equivalent pair of expression are 2(x+5)and 2x+10

-4x + 12 = -6x
Step 1: Add 4x to both sides:
12 = -6x + 4x
Step 2: Combine like terms:
12 = -2x

Answers

uh- this is the correct way to answer the problem....

−4x+12=−6x

Step 1: Add 6x to both sides.

−4x+12+6x=−6x+6x

2x+12=0

Step 2: Subtract 12 from both sides.

2x+12−12=0−12

2x=−12

Step 3: Divide both sides by 2.

[tex]\frac{2x}{2}[/tex] = [tex]\frac{-12}{2}[/tex]

x=−6

A closed box has a square base with side length l feet and height h feet. Given that the volume of the box is 29 cubic feet, express the surface area of the box in terms of l only.

Answers

Answer:

The surface area of the box in terms of l is [tex]2l^2 +116/l[/tex]

Step-by-step explanation:

The length of the box = [tex]l[/tex]

The height of the box = [tex]h[/tex]

The volume of the box can be obtained by multiplying the surface area of the base by the height of the box.

The surface area of the base of the box is a square, so it will be obtained by multiplying [tex]l \times l = l^2[/tex]

hence volume = [tex]l^2 \times h =29[/tex]

Notice that we are told to give our answer in terms of l, so we will make h the Subject of the formula in the above equation.

[tex]h =29/l^2[/tex]

In the next phase, we are to find the surface area of the box.

The box has a square base, hence it will be made up of

2 squares with 4 rectangles. This is assuming the top is closed.

This means the surface area will be

[tex]2(l^2) +4 (l\times h)[/tex]

recall [tex]h = 29/l^2[/tex]

Hence, surface area =

[tex]2(l^2) +4(l \times 29/l^2)\\2l^2 +116/l[/tex]

The surface area of the box in terms of l is [tex]2l^2 +116/l[/tex]

The surface area of the closed box in terms of l only, which has the square base is,

[tex]2l^2+\dfrac{116}{l}\;\rm ft^2\\[/tex]

What is of volume of cuboid?

Volume of cuboid or box is the amount of quantity, which is obtained by it in the 3 dimensional space.

The volume of cuboid or box can be given as,

[tex]V=l\times b\times h[/tex]

Here, (l) is the length, (b) is the width of the box and (h) is the height of the box.

A closed box has a square base with side length l feet and height h feet.  Therefore, the length and width will be the same.

The volume of the box is 29 cubic feet. Thus,

[tex]29=l\times (l)\times h\\h=\dfrac{29}{l^2}[/tex]

The surface area of the square base box is,

[tex]A=2l^2+4lh[/tex]

Put the value of height,

[tex]A=2l^2+4l\dfrac{29}{l^2}\\A=2l^2+\dfrac{116}{l}\\[/tex]

Hence, the surface area of the closed box in terms of l only, which has the square base is,

[tex]2l^2+\dfrac{116}{l}\;\rm ft^2\\[/tex]

Learn more about the volume of cylinder here;

https://brainly.com/question/12748872

Hello :)
Please help me solve this

Explain answer

Answers

Answer:

[tex]Scale\ Factor = \frac{1}{2}[/tex]

ABC dilated

Step-by-step explanation:

Given

Triangles ABC and DEF

Required

Determine the scale of dilation

First, we pick a side on ABC

[tex]AB = 6[/tex]

Pick a corresponding side on DEF

[tex]DE = 3[/tex]

The scale factor is then calculated as:

[tex]Scale\ Factor = \frac{DE}{AB}[/tex]

[tex]Scale\ Factor = \frac{1}{2}[/tex]

i.e. ABC was dilated by 1/2

Twins Isaac and Isaiah were just born. Isaac weighs 6666 pounds 2222 ounces and Isaiah weighs 5555 pounds 4444 ounces.

Answers

Step-by-step explanation:

Kindly make the question clearer for assistance

make the question more clear pls

Find each unit rate.

140 mi in 3.5 h
a.
40 mi per h
c.
0.03 mi per h
b.
143.5 mi per h
d.
35 mi per h

Answers

a. 40 miles per hour

Answer:

40

Step-by-step explanation:

took the test

3. Baskin Robbins has a new 3-gallon container of
chocolate chip ice cream. If Baskin Robbins sold
gallon on Monday, how much of the chocolate chip
Ice cream was left at the end of the day, in gallons?
muy
Expression
3 Gallons

Answers

2 gallons were left at the end of the day

Evaluate functions from their graph f(-5)=

Answers

Answer:

7

Step-by-step explanation:

(-5,7) lies in the graph!

Need help if u do I will put brainliest

Answers

the first answer is 6.1 ounce less

the 2nd answer is $3.6 more

Other Questions
ILL GIVE BRAINLYIn this political cartoon, created by Benjamin Franklin as the French and Indian War began, what do the parts of the snake represent?A. colonies bordering Spanish territoryB. French colonies in North AmericaC. The Southern ColoniesD. English colonies in North America In what ways was the Hundred Years War a new kind of war A: it was caught between nations that were becoming unified states B: it was fought between two religions. Christianity and Islam. Rather between different countries. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA what is 0.41891891891892 to two significant figures? I. Fill in the blanks below with the appropriate vocabulary in Spanish. Think about what you have learned so far.1. Es necesario estudiar mucho. = que estudiar mucho.2. Lo . No puedo ir al cine contigo.3. No voy a tomar un taxi. Voy a tomar (the bus).4. Voy a tomar el en la playa.5. Los domingos, mi familia y yo vamos a la .6. Necesito dinero. Voy al .7. Me encanta la msica! Me ir al concierto contigo.8. El metro = 9. Me gusta novelas.10. A mi hermano le gusta cartas.II. Answer the following questions with complete sentences in Spanish. When there are clues provided, use them in your answer.1. Adnde vas para comprar libros?2. Adnde van Uds. para ver una pelcula?3. Qu tienes que hacer hoy? (read a novel)4. Qu vas a hacer esta noche? (go to the museum)5. Tell someone who invites you somewhere that you are sorry but you have another engagement.6. Tienes que estudiar mucho?7. Van Uds. al correo para mandar una carta?8. Tell a friend that you would love to go to a club to dance.9. A qu hora vas a ir a la biblioteca para estudiar? (6:30)10. Por qu vas a la panadera? (I have to buy bread.)thank you! solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish A history question ????help Which graph represents all of the solutions of A delivery truck drove 52 miles per hour. It took 4 hours to travel between two towns. What is the distance between the two towns? Use the equation dert, where d is distance, r is rate, and t is time. The distance between the two towns is miles. Which scales are equivalent to 1 inch to 1 foot? Select all that apply. Group of answer choices 1 to 12 (1/12) to 1 100 to 0.12 5 to 60 36 to 3 9 to 108 PLEASE HURRY IM ON THE FINAL BEING TIMEDThe group of Muslims that believed in electing a new leader that would strictly follow Muhammads example were called __________.A.ShiitesB.SunnisC.AlisD.CaliphsPlease select the best answer from the choices providedABCD Energy that depends upon object mass and object height. How did African Americans take advantage of their new political rights, and what affect did this have on American politics Which of the following is not a function?a. (1,1),(2,2), (3,3), (4,4)b. (2,3), (2,4), (3,3), (3,4)c (2,4),(4,8).(10,12). (4,10)d. (2,4), (3,4), (5,4), (6,4) R IN Complete the following statement. The quotient of 5 = A is equal to the quotient of A +5. . B C D E O== 0 1 NEXT QUESTION O ASK FOR HELP Can anyone help me with these? It's a yes or no question... __________ powers are powers in which authority is shared by both the federal and state governments.A.ReservedB.FederalistC.DelegatedD.Concurrent Look at the following expression. Which operation should be done first?23 5 4 + 32 (a small 2 next to the 3)1.) 5 42.) 32 (small 2)3.) 4 + 34.) 23 5 Steam Workshop Downloader