When do you think the rays of the sun encounter particles

Answers

Answer 1
All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

Related Questions

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.


1. How does the human body respond to exercise?

Answers

Answer:

the heart pumps more blood and sends it to the muscles. to create more blood more oxygen is used and you start to breathe harder. if you work out hard then you might get some lactic acid build-up.

hope this helped!

identify and explain three environmental impacts of current agricultural methods

Answers

Explanation:

It is profit making practice but it causes increased level of pathogens.

It has increased the level of chemicals in our land and water.

It has increased levels of greenhouse gases in air.

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

Wyatt has heart problems

Answers

???? what is you talking about

Answer:

If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

structures in the cell

Answers

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Which statement is true about gold and helium?
O A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
c. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

Explanation:

A cactus with the genotype Kkww is crossed with a cactus with the genotype KKWw. Which of the following genotypes will be shared by 25% of the offspring?
A. KKWW
B. kkWw
C. KKww
D. KkWW

Answers

Answer: C

Explanation: Think of it this way, which ever has the most is what answer would be. So they come across 3 capitals with K its gonna be KK not kk.

Hope this helps

The genotype is defined as the genetic makeup of an organism, or the set of alleles. The cross between Kkww and KKWw will result in 25% of the progeny having genotype KKww.

The correct option is:

Option C. KKww

Find the attachment for the Punnett square, given below.

The cross between Kkww and KKWw will result in the gametes as:

Kkww - Kw, Kw, kw, kwKKWw - KW, Kw, Kw, kw

The progeny having genotype as KKww will be 4 or 25%.

Therefore, Option C is correct.

To know more about cross and Punnett square, refer to the following link:

https://brainly.com/question/14642557

Explain how autotrophs need both cellular respiration and photosynthesis

Answers

Answer:

They get energy from food. Autotrophs make their own food through the process of photosynthesis, in which light energy from the sun is changed to chemical energy that is stored in glucose. And as for cellular respiration, all organisms use it to break down glucose, release its energy, and make ATP.

Explanation:

_____________

The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB

Answers

Answer:

Image result for what is The recessive gene for blood typing

Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.

Explanation:

Brainliest if right?

Due today, please help

Answers

The nitrogen bases will only bond with one specific nitrogen base such as A - T and G - C. This is known as:

Complimentary Base Pairing

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Osmosis is important to cells because _______ *

a. cells contain fluids that are mostly water
b. cells are filled with fluids that are mostly sugar
c. cells need to be kept cool
d. cells need food

Answers

the answer would be A

Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?

Answers

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

Does anyone know how to do this????!

Answers

Answer:

Check from the internet

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

How many different ways can the 23 homologous pairs in a human germ cell arrange themselves during Metaphase I?

Answers

Answer:

eight million

Explanation:

Eight million different ways can the 23 homologous pairs in a human germ cell.

What is Homologous pairs?

One of a pair of chromosomes with the same gene sequence, locations, chromosomal length, and centromere placement is referred to as a homologous chromosome. One paternal and one maternal chromosome make up a homologous pair.

A somatic cell of a human has a total of 46 chromosomes in its nucleus. The father inherits half of them (22 autosomes Plus X or Y chromosome), while the mother inherits the other half (22 autosomes + X chromosome).

A female typically has 23 homologous chromosomes, compared to a male's 22. This is due to the fact that men' X and Y sex chromosomes are not identical. During meiosis, homologous chromosomal pairing is crucial.

Therefore, Eight million different ways can the 23 homologous pairs in a human germ cell.

To learn more about homologous chromosomes, refer to the link:

https://brainly.com/question/28459162

#SPJ2

Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass

Answers

Answer:

D. The glass.

Explanation:

Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.

Hope this helps :D

The correct answer is D. The Glass Explanation: since the atoms in solids are closer together they would transfer sound the best, because sound travels best through solids
Other Questions
On a coordinate plane, a graph decreases between (2.5, 2) and (4.5, 0.25). How does this graph change between (2.5, 2) and (4.5, 0.25)?A. IncreaseB. DecreaseC. No Change Find the volume of this shape 11 cm 16 cm PLZZ ANYONE TO ANSWER MY QUESTIONS.....I WILL GIVE BRAINLIEST. ....... 20% of 260 students at hill middle school ride a bus to school. how many students ride a bus to school? Find the Value of x and y. Iready find QR. help please and thank you n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?50% water and 50% vinager100% water100% vinageror 25% vinager and 75% water Hello! I really need help! I am stumped on these analogies for a CLUE stems sheet. 11. Ergatocracy : gerontocracy :: a. Elderly : manual b. Hard hat : cane c. Fraternity : fraternal d. Eohippus : horse 12. Status quo : revolution :: a. Form : metamorphosis b. Taxidermy : animal c. Autotroph : heterotroph d. Vivisect : dissect 13. Phenomena : phenomenon :: a. Fraternize : fraternity b. Benevolent : benevolence c. Fungi : fungus d. Saprophyte : saprogenic Solve for xPlease Help! (can u guys help me PLSSSSS ) A company sets sales goals for employees each month. A: At her current pace, how many items will Kristina sell in 28 days?B:Is she on track to meet the goal? Explain What is the percent composition of Phosphorus in Li3PO3 10. One number is twenty more than eight times another number. The sum of thenumbers is eleven. Find the two numbers. The difference of n and 2 is 10 .What is (4x2-9X+1) -(5x2-x-7) written in standard form? Why did Hamilton argue for a strong federal government Who has legislative power? QRINC offered new employees a starting salary of $34,862 in 2013. What would a comparable starting salary have been in 2003? You have a stock solution of HNO3 with a concentration of 4.5 x 10^-4 M. However, you need 275 ml of a 2.50 x 10^-5 M solution. How much of the stock solution will you need? does anyone know a free app that i can watch shows on? what show u may ask it called the 100 The population of a city is 51,000 and is decreasing at a rate of 1.75% per year. Use an exponential function to find the expected population in 5 years. Round to the nearest whole number. Steam Workshop Downloader