Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

Answer 1
The answer would most likely be whales
Answer 2

Answer:

whales

Explanation:


Related Questions

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Once in an organism, what are these atoms used for?

Answers

Atoms are the basic building blocks of ordinary matter. Atoms can join together to form molecules, which in turn form most of the objects around you. Atoms are composed of particles called protons, electrons and neutrons.

22. What do you think is the best solution for fighting climate change? (Answer
should be a minimum of 3 sentences).

Answers

Answer:

Adopting sustainable and environment friendly practices

Explanation:

Sustainable and environment friendly practices allows an individual to use available resources without depleting them and hence even the future generations have adequate supply of natural resources. Afforestation and conservation of water resources specially the potable  water sources need to be started immediately with massive force.

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

For recessive trait to be expressed you need to receive the allele from both parents. True or false

Answers

Answer:

When a trait is recessive, an individual must have two copies of a recessive allele to express the trait.

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

in pcr,
a. the gene sequence is determined
b. multiple copies of the dna sample are made
c. dna is destroyed so it has no value

Answers

Answer:

b. multiple copies of the dna sample are made

Explanation:

Polymerase chain reaction (PCR) is a method used to make millions to billions of copies i.e. complete copies or partial copies of a specific DNA sample, allowing scientists to take a very small sample of DNA and amplify it. The new fragments of DNA that are synthesize during Polymerase chain reaction (PCR) also serve as templates to which the DNA polymerase enzyme can attach and start making DNA. The result of this attachment in a production of huge number of copies of the specific DNA segment in a short period of time.

Agricultural chemicals are one source of water pollution. What is one way we can reduce their effects?"
a. biological magnification
b. nonpoint source pollutant
c. integrated pest management
d. sewage treatment

Answers

Answer:

what I think it is it's C?

I think it’s C hope it helps

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

True or false The sea otter is considered a keystone species that influences the survival of many other species in an ecosystem .

Answers

Answer:

false

Explanation:

answer: True

kind of

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

Will mark brainliest there’s a button for the pic

Answers

I'd say FLPE is the worst. It can run high temperatures but it's not safe and not safe with all foods, it's has a high cost.

Which of these represents an individual form of life such as an animal, plant, or single-celled life form?

Organ
Organism
Organ system
Tissue

Answers

Organism is the answer.
organism!! hope that helps

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?

Answers

Answer: Stabilization selection

Explanation:

Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.

Which statement is true about human population today?

A) Population is declining for the first time in history.

B) Population is rapidly declining in urban areas.

C) The time required to double the population is going down.

D) Human population is now about 5 billion.​

Answers

Answer:

The time required to double the population is going down.

Explanation:

2022 Accelerate (option D)

According to the human population today, the time required to double the population is going down.

What do you mean by human population?"Population is the whole number of inhabitants occupying an area and continually being modified by increases (births and immigrations) and losses (deaths and emigrations)." As of now, the rate of birth and immigration is higher than that of death and emigration, due to which population is increasing rapidly.The current human population estimated to have exceeded 7.9 billion.

Hence, the correct option is C. The time required to double the population is going down.

To know more about human population here

https://brainly.com/question/18508068

#SPJ2

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

what is the meaning of
•molecule
•compound
•atom
•element
•organic compound
•inorganic compound​

Answers

Molecule: a molecule is the smallest particle in a chemical element or compound that has the chemical properties of that element or compound. Molecules are made up of two or more atoms that are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons among said atoms. Although oxygen is an element, it naturally has 2 atoms (O2), because it is a halogen and in order to reach 8 valence electrons and become stable and unreactive, it bonds with another oxygen atom. This means that oxygen atoms and oxygen molecules are different; one is an element, the other is a molecule.

Pure Substance: can be divided into two sub-categories: compounds and elements.

Compound: A chemical compound is a chemical substance composed of many identical molecules composed of atoms from more than one element held together by chemical bonds. A molecule consisting of atoms of only one element is therefore not a compound, meaning that oxygen molecules (O2) are NOT compounds. NaCl, or table salt, is.

Atom: An atom is the smallest unit of ordinary matter that forms a chemical element. Every solid, liquid, gas, and plasma is composed of neutral or ionized atoms.

Element: An element is a pure substance consisting only of atoms that all have the same numbers of protons in their atomic nuclei. Elements are the base, more "pure" of the pure substances. Each element is assigned a symbol. Perhaps the most recognizable of them is H, for hydrogen.

Organic Compounds: organic compounds are generally any chemical compounds that contain carbon-hydrogen bonds. The study of these is called organic chemistry. I mean, carbon is the basis of ALL known life.

Inorganic Compounds: They are any substance in which two or more chemical elements (usually other than carbon) are combined, nearly always in definite proportions. Compounds of carbon are classified as organic when carbon is bound to hydrogen. THE OPPOSITE OF ORGANIC COMPOUNDS.

Chemistry is fun!! Hope this helps!! Have a wonderful day!!

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Other Questions
HELP HELP HELPH EPLHEPLHEPLHEPLHEPLEP A key part of the Watson-Crick model came when Watson realizedthat adenine could form hydrogen bonds with thymine and guaninecould form hydrogen bonds with cytosine. This explains why A=Tand G C in Chargaff's rules. Also, these two hydrogen-bondednucleotide pairs had the exact same width, so they could form therungs of the DNA ladder.The fact that these pairs could match up only in this way meant thatthe sequence of bases in one strand could determine the sequenceof bases in a second strand created from the first. The second strandis said to be complementary to the first strand. Individual bases arepaired so that the identity of any base determines the identity of thebase paired with it; that is, the complementary base.This table lists the base abbreviations for bases in a sample of single-stranded DNA. Fill in the second column with the base abbreviationsthat are complementary to the given bases.I Which expressions represent rational numbers? Check all that apply. Pls help Ill brainlest and add extra points asap Find the Difference: 0.325-0.01 Who is the first king of Bhutan. There are historically three 32-month periods of generally rising prices in the stock market for every one 9-month period of falling prices. This observation leads you to conclude that the stock market exhibits a: random pattern. trend pattern seasonal pattern. cyclical pattern. Why is the average approaching 3.5? What is the best song in the world nobody say its rainy tacos BJ purchased five candy bars ($.79 each) three sodas ($.169)each and four bags of chips ($.89 each). What percent of the total order was spent on sodas? if ur good at graphs come here. A spinning disc with a mass of 2.5kg and a radius of 0.80m is rotating with an angular velocity of 1.5 rad/s. A ball of clay with unknown mass is dropped onto the disk and sticks to the very edge causing the angular velocity of the disk to slow to 1.13 rad/s. What is the mass of the ball of clay When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?A. DuplicationB. NondisjunctionC. Translocation Eight friends want to play enough games of chess to be sure everyone plays everyone else. How many games will they have to play? Draw and use algebra tiles to solve the equation. 2x + 3 = 5 x = Help how many questions did you answer correctly Please select the word from the list that best fits the definition bicameral state legislature Imagine two populations of penguins live in the same ecosystem. One population begins to exchange stones as a mating ritual while the other population begins to dance by shifting from one foot to the other. Individuals from each population will only mate with individuals that display the appropriate mating ritual. Which type of reproductive isolation mechanism does this scenario describe?(1 point)Behavioral IsolationGeographic IsolationTemporal IsolationHabitat Isolation What movement were the Black Panthers a part of? NEED HELP the answers are 42 days30 days180 days24 days365 days6 days This is confusing someone please help