Which business structure is subject to the most government rules and regulations?

Answers

Answer 1

Answer: Corporation


Related Questions

100 POINTS FOR THIS QUESTION, PLEASE HURRY!!!!!!!!

Answers

Answer:

186.28 for number 4 and im sorry i dont know the other one

Explanation:

claiming points because question is old + no keywords in title

The weights of paper used for coated abrasive backings are designated by letters A, C, D and ____________.

Answers

Answer:

The weights of paper used for coated abrasive backings are designated by the letters A, C, D and E

Explanation:

The letter designation of the weights of paper backings for different applications are;

'A' Weight - Paper meant for use in finishes in abrasive projects. The paper is light (weight) touch grade of abrasive paper

'C' Weight - The 'C' designated paper is the medium light grade which offers more strength and bendability and it is suitable for woodwork by a cabinet maker

'D' Weight -  The 'D' weight category is a medium heavy paper

'E' Weight - The 'E' weight category is a strong paper category, used for discs, coarse sheets, and belts

Therefore, the letters A, C, D and E are used to designate the weights of paper used for coated abrasive backings.

An electric iron has a resistance of 12Ω and takes a current of 2A. Therefore the supply voltage will be

Answers

Answer:

24 volts

Explanation:

V=IR

V=2*12

V=24 volts

Select three types of internal customers interested in testing products.


marketing and sales people

end users

bosses

financial managers

engineers

passengers

travelers

Answers

Answer:

financial managers, bosses, and marketing and sales people

Explanation:

got the answer right :D

Which of these fuel injection systems operates with fuel injectors located only in the intake manifold near each intake
valve and sprays fuel toward the valve?
Select one:
A. Central-point injection
O B. Throttle body injection
C. Multipoint fuel injection
D. Gasoline direct injection

Answers

Answer:

C. Multipoint fuel injection

Explanation:

A fuel injection system can be defined as a system found in the engine of most automobile cars, used for the supply of a precise amount of fuel or fuel-air mixture to the cylinders in an internal combustion engine through the use of an injector.

There are different types of fuel injection system and these includes;

I. Central-point injection.

II. Throttle (single point) body injection.

III. Gasoline direct injection.

IV. Multipoint (port) fuel injection.

Multipoint fuel injection is a type of fuel injection system that operates with fuel injectors located only in the intake manifold near each intake valve and sprays fuel toward the valve. As a result, it allows for the supply of a precise amount of fuel and as such creating a better air-fuel ratio for automobile cars.

Other Questions
Given the definitions of f(c) and g(x) below, find the value of g(f(5)).f(x) = 2x 10g(x) = x2 + 6x 8 Please help me with this question The diagonals of the figure below represent the support beams for a patio covering.BE3010 yardsMAWhat is the length of each support beam?o 10 yards and 10x/3 yardsO 5 yards and 53 yardsO 10 yards and 5 yardsO 15 yards and 5 yards Need Help ASAP Thanks so much in advance... 4. Suki will soon turn 18 and wants to move into her own apartment in a few years. But she isworried that she won't be able to rent an apartment without any credit history. What can Suki doto start building a good credit hitary?a. Rent an apartment with a friend who already has signed a lease.b. Continue to use her debit card responsibly, being careful to not overdraw on the accountC. Close her checking account to avoid bouncing a check.d. Get and use a store credit card or major credit card and pay off amounts due each month. Please help if you dont mind! 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. Find the greatest common factor of 14 and 28 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 What two numbers have a sum of 215 and a difference of 137 work out 56 - 8 2 what is the order from least to greatest(38%,3/8,0.4,1/3,41%,0.33) John ate three hot dogs at a hot dog eating contest in 45 seconds. How many hot dogsshould he be able to eat in the 5 minute contest limit? show work Using the figure, angels p and w are example of Answer :)