Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk

Answers

Answer 1

Answer:

Honey

Explanation:

Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.


Related Questions


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

The cell cycle is the life of the cell from the time it is first formed from a dividing parent cell until its own division into two cells

Answers

Explanation:

cell cycle is made up of three main parts: interphase, mitosis, and cytokinesis. Most biologists agree that interphase makes up the period of time that a cell would be preparing for cell division. Cells spend the majority of their lives in this stage. During interphase a cell is going to be growing, replicating its genetic material and essentials to carry out cell division, and proofreading the genetic material to ensure replication has occurred correctly. This doesn’t sound like much, but it’s actually the longest part of the cell cycle. Once this is complete, the cell will then go through cell division and, theoretically, split into two new cells (cytokinesis).

How cytokinesis works will depend upon the type of cell that is dividing. Here is an image that summarizes the differences in cytokinesis in plant cells and animal cells, which is the classic example used in many introductory biology courses:

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue


‼️‼️‼️
Please helppp

Answers

Answer:

“Hard limits” to population growth are things like food, water, energy, technology, living space, other basic needs and economic factors which limit people’s ability to access these things.

“Soft limits” to population growth are things like education, birth control, the desire for a better life individually and a better global future for humanity, religious celibacy or chastity or abstinence, female empowerment and economic participation, the suffering already caused by overpopulation and the desire to avoid further suffering, malnutrition or non-lethal starvation which reduces sexual libido, pollution and other man made causes of involuntary sterility or low sperm count or low fertility, desire to save the environment, aversion to pain and suffering when understood that population growth causes both.

Countries with better quality of life and access to food and basic needs often have lower birth rates and lower population growth. This shows that soft limits can actually be more effective than hard limits to stop population growth. You have plenty of countries in Africa running into hard limits and having some of the highest fertility and population growth rates at the same time. They also suffer massive problems like war, poverty, disease and low standard of living. This goes to show that running into the hard limits will pretty much let things get as bad as they can get before it stops population growth. The hard limits won’t stop all the suffering caused by overpopulation but will make enough people suffer TO DEATH that the population doesn’t grow. People fear pain, thus the soft limits are more effective when they understand that population growth was responsible for pain or suffering and avoid it.

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

_____________________________ is famous for his work on natural selection.

a
Charles Darwin
b
Henry Cavendish
c
Babe Ruth
d
Isaac Newton

Answers

Answer:

a

Charles Darwin

Explanation:

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

1. Which of the following best explains how
behaviors, such as swarming and flocking, help
protect organisms?
a. Individuals in swarms or flocks act as decoys
to distract predators.
b. The movement and size of the swarm
or flock confuses predators.
c. Working together in swarms or flocks
requires less energy
d.The size of most swarms and flocks
can overtake larger predators.

Answers

d

The size of most swarms and flocks can overtake larger predators.

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción

Answers

Sobre la pregunta:

Cucigrama. Pregunta 1 vertical. Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción

Answer:

Intestino delgado

Explanation:

El intestino delgado es el organi mas largo del tubo digestivo, pudiendo medir 7 metros de longitud y 3 cm de diametro. Se caracteriza por estar sumamente plegado sobre si mismo. La primera porcion, llamada duodeno, recibe secresiones de glándulas biliar y pancreática, y las mezcla con enzimas digestivas. Esta mezcla se encarga de degradar la comida y transformarla en sustancias solubles, como amino ácidos.

Es en el intestino delgado donde ocurre la absorción de nutrientes.  Las paredes intestinales estas cubiertas por microvellosidades que aumentan la superficie de absorción.  

Las microvellosidades son células que componene el epitelio columnar, y que extienden proyecciones hacia el lumen del organo.  

 

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Which of the following best describes what carrying capacity is?
A
The quantity of marine life a limited water resource can sustain.
B
The maximum number of a population that an ecosystem can sustain.
C
The total amount of greenhouse gases a specific ecosystem can sustain.
D
The minimum number of predators a specific geographic area needs to sustain itself.

Answers

B. The maximum number of a population that an ecosystem can sustain.

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?

Answers

Answer: Stabilization selection

Explanation:

Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
Group of answer choices

secondary consumer

decomposers

primary consumer

producers

Answers

Answer:

Decomposers

Explanation:

Decomposers eat decaying or dead organisms to produce the nutrients.

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

The female gametes are called__________. *

sperm
ova

Answers

Female gametes are called ova or sperm while male gametes are called sperm. I hope this helps :)

Answer:

Woman's gametes are called Ova. Sperm is what a mans gamete is.

Explanation:

When the ocean absorbs CO2 it leads to what?

Answers

Explanation:

Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.

Answer:

If the ocean absorbs a lot of CO2 it is most likely to become acidic

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

Other Questions
Compression of mortality is the extent to which an organ can preserve essentially normal function despite decreasing cell number or cell activity. Group of answer choices True False What causes the protagonist of "The Green Morning" faint when he gets to Marsa. over excitementb. the flu c. lack of oxygen d. the site of the landscape Cmo ser la moda en cien aos, en 2017? Pues, creo que los vestidos sern mas cortos ylos estilos sern diferentes. En mi opinin, habr ms mujeres que trabajan fuera de casa, yestas mujeres necesitarn ropa para llevar al trabajo. Para la oficina preferirn ropacmoda, de telas flexibles como el algodn. Gracias a la inclusin de las mujeres en elmercado laboral, ellas tendrn ingresos y podrn comprar ms ropa, zapatos y accesorios.Necesitarn una variedad de diseos: algunos para la oficina, otros ms divertidos paracenas y eventos sociales, y todava otros para eventos especiales: vestidos de seda, bolsosde cuero, y abrigos de buena calidad. Pienso que tendremos ropa pret-a-porter en el futuro;es decir, lista para llevar, con tallas estndares. Este tipo de ropa valdr menos dinero,aunque la calidad no ser tan buena como la de la ropa hecha a medida. En cuanto a loshombres, pienso que con el paso de los aos ser mucho ms aceptable llevar ropa msinformal en varias situaciones, incluso en el trabajo. Los hombres tambin tendrn opcionesa la hora de elegir colores. La ropa de hombres incluir los colores oscuros de siempre, perotambin habr colores ms vivos y divertidos.Segn la autora del artculo, qu impacto tendr en la moda la incorporacin de las mujeresal mercado laboral? Which of the following best summarizes the outcome of the affair? A rational number equivalent to 5/7 is An arc that measures 180 degrees is called a Which sentence is written in active voice? A. The video game was bought by Badi's friend. B. Richard plays the piano for the jazz band. C. Cathryn's song was written by her father. D. The cookies were made by Rita's mother. Read the text from the following website: www.growingnation.orgA Growing NationAfter the American Revolution, the newly formed United States realized that it lacked room to grow. The states created in the Declaration of Independence in 1776 were limited in size. As the population increased, more people were competing for the same amount of land. Consequently, land became more expensive, and overcrowding became an issue. The thirteen states were bordered by the Atlantic Ocean and the territories of other nations. If the United States was going to have a future, it needed to increase its territory.President Thomas Jefferson believed that for Americans to be virtuous and free, they needed to farm land. He wanted to expand westward to create more farmland. Jefferson also wanted to obtain the Port of New Orleans at the mouth of the Mississippi River so farmers could easily transport their goods. He facilitated the purchase of New Orleans and the rest of the French territory from France in 1803 for $15 million. This new land was called the Louisiana Territory and stretched partway across the continent. It was the first step in expanding the United States.The purchase of the Louisiana Territory led to a pattern of westward expansion through payment, negotiations, and conflict. The United States purchased Florida from Spain with the Florida Purchase Treaty of 1821. Instead of paying Spain a set amount, the United States would pay the $5 million Americans claimed were owed to them by Spain. After Texas declared independence from Mexico, it was annexed by the United States and became an official state in 1845. Another land controversy occurred between Great Britain and the United States, as both countries claimed the Oregon region. The dispute was settled in the 1846 Oregon Treaty, which separated the countries by the line of the 49th parallel. Mexico refused to let the United States buy California and New Mexico, so the two countries eventually went to war. Because the Americans won the war, the United States was able to buy lands in the Southwest in 1848. The United States paid Mexico $10 million for an area of land in the Southwest in the 1853 Gadsden Purchase, stretching its borders from sea to sea.According to information in the text feature, in what year did the United States officially obtain land with access to the Pacific Ocean?1845184818211846 At 27.0C, the volume of a gas is 630 L. At the same pressure, its volume is 92,0 mL at a temperature of Franz Schubert quoted the Landler in his Piano Trio No. 1 in B-flat Major, op. 99, D. 898 by a. Writing tumbling, non-metrical rhythms b. Changing the meter c. Writing alternating 3/4 measures of eight notes and quarter notes. d. Stomping, clapping, and yodeling 673,000 in numeric help!! 2-3 values of Mrs. Jones (Mrs. Luella Bates Washington Jones) Short story "Thank you m'am" In Buenos Aires, the average daily high temperature temperature in a year is reported to be 18.2^{\circ}\text{C}18.2 C18, point, 2, degrees, start text, C, end text. Catalina believes that last year was warmer than usual. In order to test her belief, she takes a simple random sample of 202020 days from last year, and records the daily high temperature on each chosen day. She finds that the sample mean temperature is 19.1^{\circ}\text{C}19.1 C19, point, 1, degrees, start text, C, end text and the sample standard deviation is 7.9^{\circ}\text{C}7.9 C7, point, 9, degrees, start text, C, end text. Catalina wants to use these sample data to conduct a ttt test on the mean. Assume that all conditions for inference have been met. (2.810^8)(1.910^4) Over what interval(s) is the function decreasing?A)- < x < B)- < x < 5C)5D)never i need to find the square root of 16 Which two parallelograms have the same area? Solve for x. A) 13B) 26C) 11 Which theory of Interest group politics views interest groups positively?O ElitismHyper pluralismPluralismParticipatory democracy Responding to antiGerman American feeling during World War I, new names were used for_____.a.hot dogs and baked beansc.home-fried potatoesb.frankfurters and sauerkrautd.pickles and coleslawPlease select the best answer from the choices providedABCD