Which is the best description of the cause of sound waves? *

Answers

Answer 1

Answer:Sound waves are caused by the vibration of the oceans floor like a underwater volcano causes the water to vibrate

Explanation:


Related Questions

One strand of DNA contains 200 nucleotides of adenine, 300 nucleotides of cytosine, 150 nucleotides of thymine, and 100 nucleotides of guanine. How many amino acids will be in a protein encoded in this region of a DNA molecule: ........
PLEASE HELP!!!!!

Answers

Answer:

because there are only 20 different amino acid but 64 possible condoms most amino acid are indicated by more than one condon.

pick two structures from an animal cell and explain how they work together and how their functions are vital in keeping the cell alive. the options are cytoplasm, smooth er, nucleolus, nucleus, mitochondria, lysosome, and cell membrane.

Answers

Answer:

the cell membrane is the semi-permeable protective cover that keeps the cell held together. the cytoplasm is semi-fluid within the cell membrane that keeps the cell in shape.

Explanation:

In the two step cellular process of transcription and translation
(A) chromosomes line up and then are pulled to opposite ends of the cell.
(B) stem cells develop in embryonic cells, which then form adult tissue cells.
(C) the DNA double helix is separated and then replicated to form two strands of DNA.
(D) a DNA sequence is copied to form an RNA sequence, and then copied to form a protein.

Answers

Answer:

The answer is D

A is cell division, B is some stage of pregnancy, and C is DNA replication.

Is a vacuole prokaryotic or eukaryotic

Answers

Answer:

what

Explanation:

It’s presents in both

Osmosis requires energy

True
Or
False

Answers

Answer:

Diffusion and osmosis don't require the cell to expend any of its own energy, as they are passive processes. As we know both are passive processes and yet (in basic, short terms) diffusion is higher to lower and osmosis is lower to higher, so movement to concentration doesn't determine whether it is active or passive.

Explanation: ur welcome

hello pls help can you tell me if I got these right ​

Answers

Answer:

yes you got them right gj :)

Explanation:

yes, those should be the right answer

Which is common to both photosynthesis and respiration?
es
)
A
NADH is produced by Krebs cycle
B)
Chemical energy is produced in the. form of ATP
Two ATP are formed by the process of glycolysis
D)
Glyceraldehyde-3 phosphate is produced by Calvin cycle,
Matter and Ener
Hot

Answers

Answer:

the correct answer is B.

which part of a plant is necessary for photosynthesis​

Answers

Answer:

Chloroplasts

Explanation:

Answer:

chloroplasts........

"DNA replication is not considered a semi-conservative process."
True or false

Answers

Answer:

False

Explanation:

Nitrogen is a critical component of what organic compounds?

Answers

Answer:

Nitrogen is a naturally occurring element that is essential for growth and reproduction in both plants and animals. It is found in amino acids that make up proteins, in nucleic acids, that comprise the hereditary material and life's blueprint for all cells, and in many other organic and inorganic compounds.

Explanation:

(I just copy and paste from google)

Answer:

Its essential for growth and reproduction in both plants and animals.

Explanation:

It is found in amino acids that make up proteins, in nucleic acids.

which cell stucture is responsible for the passage of material into and out the cell

Answers

Hrjdusheuejebeuebwie

Please help with Meiosis! Will give brainliest!!


List the phases for Meiosis I. ________________, __________________, _________________, ______________

List the phases for Meiosis II. ________________, __________________, _________________, ______________

During prophase I the chromosomes __________________ and become ______________________.

Chromosomes that are the same size and have the same genes are called __________________ _____________

Each half of a replicated chromosome is called a ____________________________________________________

Sister chromatids of a chromosome are identical _______________________________.

Answers

Answer:

List the phases for Meiosis I: Prophase I, Metaphase I, Anaphase I, Telephase I

List the phases for Meiosis II: Prophase II, Metaphase II, Anaphase II, Telephase II

During prophase I the chromosomes coil and become shorter.

Chromosomes that are the same size and have the same genes are called homologous chromosomes.

Each half of a replicated chromosome is called a chromatid.

Sister chromatids of a chromosome are identical copies of the same chromosome.

Explanation: I hope I helped and have a great day! ^-^

when do birds use their teeth????

Answers

Answer:

to eat worms

Explanation:

Answer:

Birds do not have teeth, however...

Explanation:

[tex]--------------------------------------------[/tex]

According to The Cornell Lab, "Birds do not have teeth, however, they may have ridges on their bills that help them grip food, but this does not count as teeth. So what about birds that have “tooth” in their name, like Double-toothed Kite? Some birds of prey have a sharp ridge or “tomial tooth” on the bill that they use to bite into their prey when subduing it. But these modifications to the bill surface are not considered the same thing as individualized teeth seen in other animals."

[tex]--------------------------------------------[/tex]

Hope this helps! <3

[tex]--------------------------------------------[/tex]

A student collects 100 seeds from a group of plants produced from the
same parent plants. Of the seeds collected, 80 are blue seeds, and 20 are
white seeds. The trait for seed color is controlled by one gene and
results in seeds with either a blue color or white color.

Which Punnett square of the parent plants' traits likely corresponds
with the 100 seeds collected?

Answers

Answer:

A

Explanation:

How does geotheHow does geothermal energy differ from solar energy?

Geothermal energy is cooler and denser than solar energy.
Geothermal energy comes from the internal heat of Earth.
Geothermal energy is transmitted through the atmosphere.
Geothermal energy results from radiation of electromagnetic waves.rmal energy differ from solar energy?

Answers

Answer: B || Geothermal energy comes from the internal heat of Earth.

Explanation:

hope it helped xx :))

A scientist is using a species of green algae to study electron transport chain in photosynthesis. He uses a laser to inactivate all of chlorophyll A in the algae, but leaves chlorophyll B intact (case 1). In a separate experiment, the scientist applies a chemical to the algae that inhibits PS I but does not affect PS II (case 2).

Answers

Answer:

The scientist done wrong by inactivating chlorophyll A and PS I.

Explanation:

The scientist done wrong by inactivate chlorophyll A and PS I. If he wants to study electron transport chain in photosynthesis, he needs chlorophyll A and PS I for that because the central role of chlorophyll A is to donate electron in the electron transport chain while on the other hand, the primary function of the photosystem I is the NADPH synthesis, where it receives the electrons for PS II.

Which is the best description of the cause of sound waves?
a.a decrease in pressure
b.one object bumping into another
c.molecules becoming electrically charged
d. a vibration in material causing a vibration in an adjacent area

Answers

Answer:

the answer is d

Explanation:

When we hear something, we are sensing the vibrations in the air. The number of vibrations per second is known as the frequency, measured in Hertz (1 Hz = 1 vibration per second).

The Answer is D fs .....

Is the mesosphere temperature high or low and what is the temperature

Answers

Temperature decreases with height throughout the mesosphere. The coldest temperatures in Earth's atmosphere, about -90° C (-130° F)

Based on this evidence, a malfunction in what organelle is most likely responsible for Leigh’s disease

Answers

Answer: Mitochondria

Explanation:

Scientists discover two planets orbiting a distant star. The average distance from the star to Planet A is 4 AU, and it takes 432 Earth days for Planet A to orbit the star. If it takes 1,460 days for Planet B to complete an orbit, what is the average distance from Planet B to the star?

Answers

Answer:

3.3

Explanation:

no reason for the explanation

Answer:

C. 9 AU

Explanation:

The period (T) of Planet A is 432365=1.2 Earth years. The period of Planet B is 1,458365=4.0 Earth years. Kepler's Third Law states that

a3=kT2

Substituting the known values of a and T for Planet A, we have

43=k⋅1.22

64=k⋅1.4

k=45.7

Using this value for k, we can solve for the distance from Planet B to the star

a3=45.7⋅4.02

a3=731.2

a=9.0AU

An alternative solution is to notice that a3T2=k for both orbits, which means that the ratio a3T2 is the same for both orbits. So, 434322=x314582. Solving this proportion gives x3=729, so x=9.0AU.

Look at the punnett square above. What would be the percentage of short plants if two heterozygous plants (Tt) as seen above where to have offspring?
A. 25%
B. 50%
C. 75%
D. 100%

Answers

B
Because 25+25 is 50

what determines the traits of an organism

a. Relation of AT to CG base pairs
b. number of nitrogen bases in RNA
c presence of ribose or deoxyribose in a nucleic acid
d sequence of nitrogen bases in DNA​

Answers

Answer:

A

Explanation:

I think this is because the base pair orders change from person to person.

Help plz! To identify a species, you must first do what?

Answers

Answer:

look at the animal and or fossil and relate it to others

Explanation:

Answer:

To identify the species you must first need to find following things -

I) whether the organisms is unicellular or multicellular

ii) Mode of nutrition

iii) Place where it lives

if) Body structure.

Identify the tonicity of the solution surrounding the cell.

Answers

Answer:

Hypertonic

Explanation:

Hypertonic solutions have less water ( and more solute such as salt or sugar ) than a cell. Seawater is hypertonic. If you place an animal or a plant cell in a hypertonic solution, the cell shrinks, because it loses water ( water moves from a higher concentration inside the cell to a lower concentration outside ).

Red blood cells are classifed as type A or type B, based on their surface antigens. Type O
blood does not contain any antigens. The chart below shows the possible phenotypes of
each blood type.
Blood Types
Blood Type Phenotype Alleles
B:
AB
B
AB
Which mechanism explains how both A and B antigens produce type AB blood?

Answers

Answer:

codominance

Explanation:

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

what is antigen?

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.

Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

Learn more about the antigen here

https://brainly.com/question/30587809

#SPJ2

What do the indicators used by economists reveal?

changes in production and demand
changes in employment levels
changes in prices
changes in the health of an economy

Answers

Answer:

4

Explanation:

Changes in the health of an economy

The Indicators used by economists reveal changes in production and demand.

What are indicators?

Indicators are measures or steps economist use to show the significance or effect of a factor in an economy. It is use to classify and state the happenings in an economy and how effective those factors are.

Therefore, The Indicators used by economists reveal changes in production and demand.

Learn more about indicators below.

https://brainly.com/question/1357308

#SPJ5

How are proteins and nerve cells interrelated?​

Answers

Answer:

The answer to Your Question Is down below :)

Explanation:

Working with mice, scientists have discovered that a particular protein helps nerve cells extend themselves along the spinal cord during mammalian development.

which statement describes a possible effect of climate change

Answers

Answer:

Where is the question??

Explanation:

Add an attachment

PLEASE HELP!!
The process, below, does what to benefit a cell? *
Prevents osmosis from causing a cell to shrivel or rupture.
Allows white blood cells to tag pathogens with antibodies.
Decreases the necessary activation energy to speed up the chemical reaction.
Increases the necessary activation energy to slow down the chemical reaction.

Answers

Answer:

Decreases the necessary activation energy to speed up the chemical reaction.

Explanation:

This picture shows substrates binding to the activation site of an enzyme causing the enzyme to change shape and therfore speeds up the chemical reaction.  

Messenger RNA carries a(n) ___________ of the DNA’s instructions out of the nucleus to the ___________.

Answers

Answer:

transcript and ribosome

Explanation:

I know this for sure

Other Questions
Which ordered pairs are solutions to the inequality 3x-4y>5 Question 14An element's periodic table identity is defined by its number of.neutrons.Bisotopes. Celectrons.protons ASAP HELP!!!!! For earth science What is the phase of a star called where it simply cools and fades away? list two examples of temporary change in human SOMEONE, PLEASE HELP LITERALLY STRUGGLING!!!!!! Circle 1 represents students involved with drama after school, circle 2 represents students involved in sports, and circle 3 represents students in academic club activities. What can you conclude about students who fit in region B?A.Region B represents the students involved in sports only.B.Region B represents the students involved in sports and academic clubs.C.Region B represents the students involved in drama and sports.D.Region B represents the students not involved in academic clubs.Please select the best answer from the choices providedABCD Who became the first governor to be inaugurated in the New Capitol in 1904? 1. How did Jeannette catch on fire in the beginning of the novel? *1 pointa. She was making herself pasta while Rose Mary watched and painted.b. She was testing chemical reactions with toxic chemicals in a shed near her house.c. She was throwing toilet paper that was on fire down the toilet.d. She was cooking hot dogs by herself. 3Which statement below best completes the chart?Water shortages occurred as more people moved to rural areas4Air pollution levels increased as governments eased regulationsCities grew in size as previously used farmland was absorbed by rural areas5Cropland eroded as farmers used outdated technique Joe would have earned $504 for working a 42 hour week but he was sick and missed 4 hours. How much did he earn? Help asap please!! I will mark you as brainliest :) As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Steam Workshop Downloader