Which is the solution to this system of equations?
x - 2y= 15
2x + 4y = -18

Answers

Answer 1
The answer to your problem is 3 and -6

Related Questions

I need help ASAP x-3/8=3/20

Answers

Answer:

Step-by-step explanation:

6/8 can be simplified to 3/4. Therefore the answer is C. 20 X 3/4

Answer:

[tex]x=0.525[/tex] or [tex]x=\frac{21}{40}[/tex]

Step-by-step explanation:

Which is the graph of x-y=1

Answers

Answer:

here you go! :)

hope it helps!

Step-by-step explanation:

There hope it helps

please solve will give brainiest

Answers

Step-by-step explanation:

BODMAS

155.5-5.5*20.7

155.5-113.85

=41.65

Answer:

41.65

Step-by-step explanation:

155.5-(5.5*20.7) order of operation

155.5-113.85=

41.65

3x−x+3−9=6
i cant solve this ​

Answers

Answer:

3x - x + 3 - 9 = 6

3x - x + 3 = 6 +9

2x +3 = 15

2x = 15 - 3

2x = 12

x= 12/2

x= 6

Rules - When the side changes , sign changes .for ex (-9) on changing side (from left to right ) becomes plus 9

What is the largest possible integral value in the domain of the real-valued function

f(x)=[tex]\frac{1}{\sqrt{800-2x} }[/tex]

Answers

Answer:

Max Value: x = 400

General Formulas and Concepts:

Algebra I

Domain is the set of x-values that can be inputted into function f(x)

Calculus

AntiderivativesIntegral Property: [tex]\int {cf(x)} \, dx = c\int {f(x)} \, dx[/tex]Integration Method: U-Substitution[Integration] Reverse Power Rule: [tex]\int {x^n} \, dx = \frac{x^{n+1}}{n+1} + C[/tex]

Step-by-step explanation:

Step 1: Define

[tex]f(x) = \frac{1}{\sqrt{800-2x} }[/tex]

Step 2: Identify Variables

Using U-Substitution, we set variables in order to integrate.

[tex]u = 800-2x\\du = -2dx[/tex]

Step 3: Integrate

Define:                                                                                                            [tex]\int {f(x)} \, dx[/tex]Substitute:                                                                                         [tex]\int {\frac{1}{\sqrt{800-2x} } } \, dx[/tex][Integral] Int Property:                                                                                     [tex]-\frac{1}{2} \int {\frac{-2}{\sqrt{800-2x} } } \, dx[/tex][Integral] U-Sub:                                                                                           [tex]-\frac{1}{2} \int {\frac{1}{\sqrt{u} } } \, du[/tex][Integral] Rewrite:                                                                                          [tex]-\frac{1}{2} \int {u^{-\frac{1}{2} }} \, du[/tex][Integral - Evaluate] Reverse Power Rule:                                                 [tex]-\frac{1}{2}(2\sqrt{u}) + C[/tex]Simplify:                                                                                                         [tex]-\sqrt{u} + C[/tex]Back-Substitute:                                                                                            [tex]-\sqrt{800-2x} + C[/tex]Factor:                                                                                                           [tex]-\sqrt{-2(x - 400)} + C[/tex]

Step 4: Identify Domain

We know from a real number line that we cannot have imaginary numbers. Therefore, we cannot have any negatives under the square root.

Our domain for our integrated function would then have to be (-∞, 400]. Anything past 400 would give us an imaginary number.

the bee hummingbird is the smallest bird. it can weigh as little as 2 grams. the largest bird, the ostrich, can weigh as much as 150 kilograms. the hummingbird's weight is what percent of the ostrich weight?

Answers

Answer:

1.3%

Step-by-step explanation:

i dont have an explanation

1.33 percent

When you divide 2 by 150 you get .0133333333. You move the decimal point two places to the right because it is a percentage out of 100. You round the number because the 3s continue forever.

18.
The perimeter of a rectangle is 42 inches. The length of the rectangle can be represented by x + 4 and its width can be represented by 2x minus 7. What is the width of the rectangle in inches?

8

9

12

10.3

Answers

p=2(l+b) =2(3x-3) =6x=48=x=8

Answer: It’s 8

Step-by-step explanation:

Find the slope of the line. Enter your answer as
a number, fraction, or undefined. Reduce to
lowest terms where necessary.

Answers

Answer:-3/5

Step-by-step explanation:

Rise over run

convert 3 4/5 into a improper fraction with steps please

Answers

Answer:

Step-by-step explanation:

((3×5)+4)/5=

19/5

The improper fraction is 19/5.

We have to convert [tex]3 \dfrac{4}{5}[/tex]  it into an improper fraction.

To convert into an improper fraction calculation must be done in a single unit following all the steps given below.

 Step1; Write the fraction into simple fractions,

                    [tex]= \dfrac{3 \times 5 + 4}{5}[/tex]

Step2; Solve the following equation.

                    [tex]=\dfrac{15+4}{5}\\\\=\dfrac{19}{5}[/tex]

Hence, The improper fraction is 19/5.

To know more about Fractions click the link given below.

https://brainly.com/question/21449807

4 ten and 17 hundredth in decimals UNSERIOUS ANSWERS REPORTED

Answers

Answer:

40.17

Step-by-step explanation:

4 ten: 4 × 10 = 40

17 hundredth: 17 × 0.01 = 0.17

4 ten and 17 hundredth in decimals: 40 + 0.17 = 40.17

Geometry...Please help as soon as possible please and Thank you so much!

Answers

Answer:

Step-by-step explanation:

Statement1. ∠KJL ≅∠LMK (A)

Reason1. Given

Statement2. ∠JKL≅∠MLK (A)

Reason2. Given

Statment3. KL≅KL (S)

Reason3. Reflexive propriety

Statemnt 4. ΔJKL≡ΔLMK

Reason 4. AngleAngleSide congruency theorem

Help me I don't know how to find the percent of discount to the nearest percent

Find the percent of discount to the nearest percent.

skateboard: regular price, $24
sale price, $15.50


help. PLEASE.

Answers

Answer:8.5

Step-by-step explanation:

Answer:

step one

find the difference between marked price and the selling price, which is 24-15.50=8.5

step two apply the formula which is, difference divided by marked or original price and then multiple by 100

eg (8.5÷24) × 100= 35.4

so now round off to the nearest percent that's 35%

Which are the solutions of the inequality − 2x > − 4?
Choose all that apply.
A 2
B 1.5
C 1
D 3.5
E 2.5
F −2

ASAP!!!!!!!

Answers

Answer:

B,C&F

Step-by-step explanation:

-2x>-4

multiplied by -1 gives 2x<4

And you devide both sides by 2 you get x<2

The numbers smaller than 2 in your options are 1,1.5 and -2

Lashonda has bought 18 pounds of dog food. She feeds her dog 2/3 pounds for each meal. For how many meals will the food last? Write your answer in simplest form.

Answers

Answer:

she have feed 26 or 27

Step-by-step explanation:

I am confused it's 26 or27

help find this please

Answers

Answer:

B

Step-by-step explanation:

Which graph represents the equation y = 3/4 x - 3

Answers

Answer:

Step-by-step explanation: you forgot to attach the file but it should look like this i think

Answer:

slope is 3/4

y-intercept is (0,-3)  Thats where you put your first point on the y-inter on -3

x    y

0   -3

4     0

Put your second point at 4 (on the x)

then your slope is rise /run 3/4

then you should get your line on your graph

Step-by-step explanation:

Kąty α i β są kątami przyległymi. Kąt wyznaczony przez dwusieczne kątów α oraz β ma miarę A) 90∘ B) 4 5∘ C) 60∘ D) różną, w zależności od miar kątów α i β

Answers

Answer:

i have

Step-by-step explanation:

i dont even know good luck

solve the equation 2(x+2x)=36

Answers

Answer:

x = 6

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Equality Properties

Algebra I

Combining Like Terms

Step-by-step explanation:

Step 1: Define Equation

2(x + 2x) = 36

Step 2: Solve for x

Combine like terms:                    2(3x) = 36Divide both sides by 2:               3x = 18Divide both sides by 3:               x = 6

Step 3: Check

Plug in x into the original equation to verify it's a solution.

Substitute in x:                   2(6 + 2(6)) = 36Multiply:                              2(6 + 12) = 36Add:                                    2(18) = 36Multiply:                              36 = 36

Here we see that 36 does indeed equal 36.

∴ x = 6 is the solution to the equation.

Answer :

2(x+2x)=36

2x + 4x =36

6x =36 is the answer

Hope it helped

The measure of angle DCF is ... degrees?

Answers

Answer: Yes, The measure of DCF is degrees.

How do I find the measurement indicated in each parallelogram.

Answers

Answer:

17) 23

18) 12

Step-by-step explanation:

17

x+15 = 7+2x

x-2x = 7-15

-x= -8

x=8

WX = x+15

= 8+15

= 23

18

2x = 3x-6

2x -3x = -6

-x = -6

x = 6

EF = 3x-6

= 3(6) -6

= 18 -6

= 12

Answer is 17 u need to write 17

A store starts the day with 36 packages of juice boxes.Each package contains the same number of juice boxes.By the end of the day,ther are only 8packages of juice boxes left.

Answers

Answer:

Number of package sold = 24 package

Step-by-step explanation:

Given:

Total number of package = 36

Remain package = 8

Computation:

Number of package sold = Total number of package - Remain package

Number of package sold = 36 - 8

Number of package sold = 24 package

I’m please help asap due soon

Answers

The answer is 51. Hope this helps

(WORTH 20 POINTS) Please help I don't know how to do this

In your own words, what do the terms sales tax and discount mean? Is a 5 percent sales tax a percent of increase or decrease? What about a 15 percent discount?


lol help-

Answers

Answer:

Sales tax is an increase in the price of the item while a discount is the decrease of the price. A 5% sales tax is an increase since your paying an extra 5% of the item price. 15% discount is a decrease since your now only paying 85% of the original price. Hope that helps

Answer: In layman's terms, that means if the original price of something you sell was $100, but you offer a 50% discount, then the taxable price is $50. Sale Price = original price – (% of discount * original price)

Sales Tax = Sales Tax rate * Sale Price.

Sales Tax = 0.05 * $17.21 = $0.8605 = $0.86. How do I add 5% to a number?

Divide the number you wish to add 5% to by 100.

Multiply this new number by 5.

Add the product of the multiplication to your original number.

Enjoy working at 105%!

Lamar drinks 8 ounces of water with breakfast, 6 ounces of water with his vitamins, 16 ounces of water with his lunch, 16 ounces of water with his dinner, and 32 ounces of water from a bottle he carries throughout the day. Write and evaluate a numerical expression for the amount of water in ounces that he drinks in a week.

Answers

Given:

Lamar drinks water with,

Breakfast = 8 ounces

Vitamins = 6 ounces

Lunch = 16 ounces

Dinner = 16 ounces

Bottle = 32 ounces

To find:

The a numerical expression for the amount of water in ounces that he drinks in a week.

Solution:

One day consumption of water by Lamar is

[tex]8+6+16+16+32=78[/tex]

We know that,

1 week = 7 days

One day consumption of water = 78 ounces

1 week (7 days) consumption of water = 7× One day consumption of water

                                                               = 7×(8+6+16+16+32) ounces                                                                

                                                               = 7×78 ounces

                                                               = 546 ounces

Therefore, the required numerical expression for the amount of water in ounces that he drinks in a week is 7×(8+6+16+16+32) ounces and the value is 546 ounces.  

Solve the inequality. 4v + 9 ≤ 5 or -3 >= -6​

Answers

Answer:

v ≤  − 1   or  Always true

Step-by-step explanation:

I hope this helps!

Answer:

v ≤  − 1

Step-by-step explanation:

write two numbers that multiply to the value on top and add to the value on the bottom.

Answers

Answer:

1 and 19

Step-by-step explanation:

I believe this is a factoring problem.

Example:

If we have the equation x^2-2x-3

We can find two numbers that multiply to -3 that add to -2

The two numbers are -3 and 1

(x-3)(x+1)= So x=3 and x=1

Answer:

1 and 19

Explanation:

1x19=19

1+19=20

When a system of linear equations is graphed, how is the graph of each equation related to the solutions of that equation?​

Answers

Answer:

The solution of such a system is the ordered pair that is a solution to both equations. To solve a system of linear equations graphically we graph both equations in the same coordinate system. The solution to the system will be in the point where the two lines intersect.

Step-by-step explanation:

Frenando finished 6/8 of his homework greta finished 6/8 of her homework find a fraction that represent the amount of work that greta finished in a different form but equal to 6/8

Answers

Answer:

3/4

Step-by-step explanation:

you can write it in a different form by simplifying. 6/2 = 3. 8/2 = 4 so the answer is 3/4

A map of Long Island has the scale 2.75 cm= 16km. On the map, target Rock is 23.2 cm from Lake Montauk. Find the distance from Target Rock to Lake Montauk. PLEASE HELP ASAP

Answers

Answer:

ytjyhyjhuyjhytujhyuhjnfh

Step-by-step explanation:

Item 19 A sports store donates basketballs and soccer balls to the boys and girls club. The ratio of basketballs to soccer balls is 7 : 6. The store donates 24 soccer balls. How many basketballs does the store donate? The store donates basketballs. Item 19 A sports store donates basketballs and soccer balls to the boys and girls club. The ratio of basketballs to soccer balls is 7 : 6. The store donates 24 soccer balls. How many basketballs does the store donate? The store donates basketballs.

Answers

Answer:

28 soccer balls.

Step-by-step explanation:

Let there are 7x basketball and 6x soccer balls.

A sports store donates basketballs and soccer balls to the boys and girls club.

The store donates 24 soccer balls.

It means,

6x = 24

x = 4

No of basketballs = 7x

= 7(4)

= 28

Hence, the store denote 28 soccer balls.

Other Questions
Help plzzzzzzzzzzzz d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec Community health problems can be addressed through the provision of health education. Justify it Steam Workshop Downloader