Which most supports the fact that Trifles is written in a realistic style?
The characters are portrayed as in real life.
The audience is actually involved in the play.
The setting is presented in an unusual way.
The characters are formal and exaggerated

Answers

Answer 1

Answer:

A. The characters are portrayed as in real life.

Explanation:

This is the answer i got on edge hope it helps :)

Answer 2

What most supports the fact that Trifles is written in a realistic style is The characters are portrayed as in real life.

What is Realism?

Realism can be regarded as the art style which is based on the making pieces look as been realistic.

Therefore, in Trifles the characters are portrayed as in real life which makes it a realistic style.

Learn more about Realism at;

https://brainly.com/question/541923


Related Questions

“The women asked for a new set of false teeth in payment for making the boots”
Change this into passive voice

Answers

Answer:

Hey mate

Explanation:

For making the payment of the boots the women asked for a new set of false teeth.

pls mark me as brainliest!!

What is the conclusion on Lone Dog?

Answers

Answer:

When Kaya befriends a lone dog that has wandered near her camp, others in the village warn her to be careful. Dogs don't usually live by themselves, and some people think the lone dog is not to be trusted. But Kaya brings the dog food and can feel her gratefulness. After Lone Dog gives birth to pups, she lets Kaya be a part of her new family. When Kaya looks into Lone Dog's eyes, it's as if the dog is speaking to her. Kaya's grandmother tells her that if an animal speaks to her, she needs to listen. But as the pups grow older, Lone Dog has something else to say -- something that Kaya doesn't want to hear.

Explanation:

Giving brainlyiest Marcie observes a boat floating on water and tries to explain to her mother why the boat is not moving.

Which of the following explanations is the best to use?

A The force of gravity acting on the boat is the same as the force of the water pushing up. This means the forces acting on the boat are balanced.

B The force of gravity acting on the boat is the same as the force of the water pushing up. This means the forces are unbalanced.


C The force of the water pushing up on the boat is greater than the force of gravity pulling the boat down. This means the forces acting on the boat are
balanced

D The force of the water pushing up on the boat and the force of the boat pushing itself up allows the boat to float. The two forces are balanced

Answers

Answer:

The force of gravity acting on the boat is the same as the force of the water pushing up. This means the forces acting on the boat are balanced.

Explanation:

The force of gravity acting on the boat is the same as the force of the water pushing up. This means the forces acting on the boat are balanced.

HELP ME NOW PLZ FOR BRAINLIEST Question 1(Multiple Choice Worth 5 points)
(MC)

Read the excerpt below. Which of the following statements best summarizes the main idea of the excerpt?

In 1944 Elion joined the Burroughs Welcome Laboratories (now part of GlaxoSmithKline (a company that makes prescription medicines)). There she was first the assistant and then the colleague of Hitchings, with whom she worked for the next four decades. Elion and Hitchings developed an array (variety) of new drugs that were effective against leukemia, autoimmune disorders, urinary-tract infections, gout, malaria, and viral herpes.

A). Elion believed that new drugs could be developed to help people.
B). Elion had to work for Hitchings because she was a woman.
C). Elion worked hard for more than 40 years to earn money for retirement.
D). Elion and her colleagues were responsible for developing important drugs.

Answers

Answer:

Choice D : Elion and her colleagues were responsible for developing important drugs.

The only thing it talked about was Elion's journey thru the Lab and how they met Hitchings and created important drugs, ergo, option D.

~That's All Folks~

-Siascon

Answer:

D. Elion and her colleagues were responsible for developing important drugs.

When the teacher entered to class we -———(finish /finished /had finished ) our work

Answers

When the teacher entered the class, we had finished our work.

Therefore, C - Had Finished is the correct answer.

Using the right Tense

The sentence above has two events. They are:

Finishing HomeworkThe teacher entering the class.

Notice that both occurred in the past. The rule of proper use of verbs states that where both events have occurred, and one before the other, the proper tense to use is the past perfect tense.

See the link below for more about Past Perfect Tense:
https://brainly.com/question/4161654

what is your favorite television show?​

Answers

Answer:

castle, the best show ever. you should watch it meryl the actors have the best chemistry in tv history.

Selling Sunset! Best show you will ever watch!

Which sentence most clearly contains an idiom?

a. the Manhattan Project involved thousands of people.
b. she was mad, but she had bigger fish to fry that day
c. " I told you" Rhonda said "I just got here yesterday"
d. Rain thumped against the tin roof of the small trailer.

Answers

Answer:b. she was mad, but she had bigger fish to fry that day

Explanation:

the answer is c your welcome

25) You have been assigned to write an essay on poisonous plants. Which background reading would be most helpful as you formulate your ideas for a first draft? A) an article explaining why some people react to poison oak and poison ivy B) an autobiography of a young girl raised in the fertile plains of Iowa C) a how-to book describing how to plant and care for a vegetable garden D) a persuasive essay about why "going green" is essential for the environment

Answers

Answer:

it is answer choice a since poison oak and poison ivy are poisonous plants, thus being relevant to the subject

Answer:

A

Explanation:

If the essay is about poisonous plants, you would read more information about poisonous plants.




9. (a) Support What was the "lie" Hugo Meisl's parents told Hugo and his brother before they sent them away ?

Answers

Hugo's parents told him that he and his brother would spend a month or two on vacation in England and then they would pick them up. However, it was all a lie.

We can arrive at this answer because:

Hugo's parents wanted to free him and his brother from the violence of the Naxists against the Jews.They knew that everyone would be persecuted and possibly exterminated.For that reason, when they had the chance to send their children to England they didn't think twice, as it was the children's only chance to escape.

Hugo's parents knew that he and his brother would be very sad to know the real reason for the trip, mainly because the chances of never seeing their parents again was very high, for this reason, they lied to their children so that they could make the trip with more peace of mind.

This question is about "Saving the Children."

More information about Nazism at the link:

https://brainly.com/question/538471

Racing to Race

Carlo stopped to rest for a minute and tried to catch his breath. He’d been running for so long that he had pains in his side and his legs were beginning to hurt. He hunched over and tried to expand his lungs, but it was like trying to suck air out of a bicycle tire. His body was too exhausted to even allow him to take a deep breath, and he started to wheeze again.

“Great,” he thought, “let me just add asthma to my expanding list of ailments. I can’t believe that I can’t even jog two miles without completely collapsing!” He finally gave in to his aching body and laid down on the grass to recuperate. He closed his eyes and tried to imagine himself running on the school track in the 1,600-meter race. He pictured himself running steadily toward the finish line, running effortlessly like a cheetah in the jungle. He was so lost in thought that he didn’t even hear Meiya approach.

“Hey sleepyhead, what are you doing napping on Sean’s lawn in the middle of the day?” Meiya asked playfully.

Carlo quickly sat up, breathing normally now and feeling a little embarrassed. “I am trying to get in shape to try out for track, but I can’t even run two miles,” he said dejectedly.

“Wait, how many months are you out of surgery? Didn’t you just finish rehab last week?” Meiya asked. “You can’t expect to run two miles the first day.”

It had been six months since Carlo’s surgery and he specifically remembered the doctor telling him he could start running after six months. But he thought about what Meiya had said and realized she had a good point. After his surgery, the doctor did say rehab would be crucial to his recovery but that it would take time for him to gain back full use of his leg. He thought about how a baby had to learn to walk before it could run. He remembered when his nephew was learning to crawl; within days it seemed like he was walking. Running didn’t come right away, Carlo remembered. He realized it was the same with his therapy. The maximum he had run in the past month was one mile on the treadmill, so he realized that Meiya was probably right. He would have to work at building up his endurance and set more realistic goals for himself. As he thought about what he had already accomplished, he started to smile and felt like a weight was being lifted off his shoulders. He realized that he had run almost a mile and a half before his body started to protest and if he kept working hard, he could get back to where he was before his accident.

“Since when did you get so smart, Dr. Meiya?” he teased. “Do you want to race to the next mailbox?”

“You’re on!” she challenged and took off running at full speed.



Question 1
Part A

What is a central theme of “Racing to Race?”


Running a race is not always about winning.

Good things always come to those who wait.

A close friend is good medicine.

Recovery from a setback takes time and patience.
Question 2
Part B

Which statement best shows how the theme identified in Part A is developed in the story?


Carlo realizes that he may not be able to compete on the school track team but also discovers that, with time, he will still be able to participate in a sport he loves.

Carlo is discouraged that he has to rest after running a short distance, but Meiya reminds him that he has only just finished rehab.

Meiya knows that she is faster than Carlo, so she does her best to encourage him and also lets him win a race between them to boost his spirits.

Carlo pictures himself winning a big race on the school track team but then he realizes he may have developed asthma.

Answers

Answer:

great job

Explanation:

I think u got it right

Rohan borrowed my pen change into interrogative​

Answers

Answer:

Did Rohan borrow my pen?

Hope it helps...

the nearest meaning of apparent​

Answers

Apparent can have two different meanings. The first meaning is when something is easily understood and/or obvious. Example: "it became apparent quickly that he didn't care" The second meaning is when something seems real or true, but not necessarily. Example: "his apparent lack of empathy" Hope that helps. :)

Reread the sentences from the passage. Then tap the words
"these recommendations" to begin the activity.

Answers

Answer:

Exercise and a balanced diet.

Explanation:

Exercise and a balanced diet are the only other positive recommendations that the phycians advised. The sentence is adding on to the previous statement.

The __________ step of the Study Cycle involves reflecting on your mastery of understanding. In this step, you should ask yourself if you understand the material enough to teach it to someone else.
Preview
Attend
Review
Study
Check

Answers

Answer:

Review

Explanation:

Review The Answer To Be Sure

The Review step of the Study Cycle involves reflecting on your mastery of understanding. In this step, you should ask yourself if you understand the material enough to teach it to someone else. Hence, option C is correct.

What is Review step?

The reporting manager or team leader uses the review process to determine how well people are performing in regard to the purpose and goals. It involves comparing results to predefined standards and providing personnel comments on the results.

A rigorous review process is necessary to accomplish effective risk management. It aids in outlining the thoughts and perspectives held at the start of a process and raises awareness of the challenges the process may face.

A project review is a process a business uses to evaluate the success of a certain project and decide if it should have funding moving forward.  

Thus, option C is correct.

For more information about Review step, click here:

https://brainly.com/question/20098365

#SPJ2

What are some characteristics for consequences?

Answers

Answer:

Robert Louis Stevenson had something interesting to say about this:

Everybody, sooner or later, sits down to a banquet of consequences.

In other words, consequences aren't just for the guilty, they're for everybody. Our actions will, eventually come home to roost in the form of consequences : We will get what. ??

Explanation:

Hope this helps !!

Why do the pigs organize more songs, more speeches, and more processions for the
animals?
This is for Animal Fram by the way!

Answers

Answer:

The increased amount of songs, speeches, and demonstrations keep the animals' brains busy enough not to think about their own wretchedness

Explanation:

Is this a good poem?

It comes quick with Nay warning
It’s cold aura oh so haunting
Wilt Thou live it’s hard to say
If Thou argue Thou seal Thy fate
On the cold street haunting Thy dreams
Thou beg Thou plead
But deep down Thou know Thou agree
You’ve done bad things
Thou thought they'd never noticed
Three strikes Thou swing
Thy out of the game
Thou may be cunning
But Thither's Nay point in running
Death Wilt catch up
It is quick
It comes fast
With Nay warning
Thou open the mast
Set sail to the seas
But it catches up
As quickly as can be
Thou panic
Thou cower
Thou gaze in terror
It is ready
To devour
Thou jump
Trying to flee
But it jumps
Swimming after Thou
Why do Thou run
Why do Thou hide
Thou know Thou cannot escape
For death comes quick with Nay warning
Thou swim deeper and deeper
Trying to escape
Death’s cold grasp
But Thou look back
Only to see
Death is not to be seen
Then Thou realize
Then Thou panic
For now Thou know
Thou are dead

Answers

yes i think it is a great poem good job

is Henry C. Gatz Gatsby’s father?

Answers

Answer:

Yes

Explanation:

---------------------------------------------------------------------------------

write a paragraph about visit to the Art gallery by using present continuous tense​

Answers

Answer:

hope it helps :)

Explanation:

Last Sunday, and exhibition of paintings by eminent painters was held in the Lions Club Hall in our town. I, along with my friend, Naresh, went to see it. All the walls of the Hall were covered with the paintings. There was iron railing in front of the walls on every side. The spectators could see the paintings from a distance of ten feet. Some of the paintings exhibited were realistic while others were impressionistic. It was difficult to understand the abstract paintings. But the guides helped the spectators in understanding those paintings. In one huge painting, The painting of a row of camels in desert was very beautiful. There was a series of portraits and martyrs. The portrait of Shaheed Bhagat Singh was really marvelous.to a section on modern art were really difficult to understand. Everybody had his or her own interpretations of these paintings. This gave rise to a very lively and useful discussion on art. My visit to this exhibition was really memorable.

write 2 pharagraphs on a song you hate telling why plzzz.

Answers

Answer:

Title: Who Let The Dogs Out by Baha Men

Explanation:

This song wasn't suppose to exist because it's just that horrible. It's actually about men who catcall women and call them names and are disrespectful and the women respond by calling them dogs. That's why I don't like it.

Another reason is that why would you do that to women? It is indeed disgusting to name a person that so it is ABSURD! I wish this was longer but that's it. brainliest please UuU

Read the poem and answer the question.

[1]I wandered lonely as a cloud
That floats on high o'er vales and hills,
When all at once I saw a crowd,
A host, of golden daffodils;
[5]Beside the lake, beneath the trees,
Fluttering and dancing in the breeze.

Continuous as the stars that shine
And twinkle on the milky way,
They stretched in never-ending line
[10]Along the margin of a bay:
Ten thousand saw I at a glance,
Tossing their heads in sprightly dance.

The waves beside them danced; but they
Out-did the sparkling waves in glee:
[15]A poet could not but be gay,
In such a jocund company:
I gazed—and gazed—but little thought
What wealth the show to me had brought:

For oft, when on my couch I lie
[20]In vacant or in pensive mood,
They flash upon that inward eye
Which is the bliss of solitude;
And then my heart with pleasure fills,
And dances with the daffodils.

Wordsworth uses the word "dance" throughout his poem. In a paragraph of 3-5 sentences, analyze how the poet uses "dance" in stanzas 1 and 4. Who is dancing in these two stanzas? In each instance, what does the use of the word "dance" reveal about Wordsworth's view of nature?

Answers

Answer:

The daffodils are dancing! Not literally, of course, since this is personification. Wordsworth sees nature as beautiful and light, like how a dancer would be. It shines light on the good of the world, in the form of making something as non-human as a flower have more human qualities.

Explanation:

By "human qualities" I mean things like dancing, singing, holding objects, talking, whispering, etc.

find HCF of 27 and 45 ​

Answers

Explanation:

HCF of 27 and 45 is 9.

hope my answer is helpful to you

persuasive writing smoking cigarette

Answers

Answer:

Cigarettes, the most common form used for smoking, carries thousands of substances, many which will bring devastating side effects. When one smokes, he or she is breaking down their body into pieces by just the practice of inhaling. The problem of smoking in the society is that it does not simply affect just him or her. This can lead to second hand smoking and onto third hand smoking as well. Although opinions are divided, second hand smoking is just as severe as first hand smoking, as the rate of particle pollution in the air increases up to 900 times more after the first three minutes one has been exposed to the smoke. Smoking can also be destructive to the public as it can happen almost everywhere. Whenever one has a packet of cigarettes.

When the cost of the cigarettes rise nearly 10~20% a year, a high percentage of people, both adults and minors decrease the amount of smoking. Although different for each brand, Australia has been considered the country with the most expensive cigarettes. The fact that a pack is over 15 dollars discourages many against smoking, and most find a way to quit due to the high price. With the income from the raised costs of cigarettes, education and promotion are put into effect. Educating both the younger and older generation helps prevent new smokers from appearing by teaching the downside of cigarettes and the danger it holds to one’s health. Promotions can come in various methods, such as having warning signs and ingredients labelled properly on the cigarette pack. Mass media is a common method used, where dramatic advertisements are shown to depict the side effects of smoking. This could easily be done by simply sending out pictures of damaged lungs, the state of one’s oral systems, and more.

Explanation:

The opening paragraph of an essay should contain which of the following?

A.

the supporting details of a paragraph

B.

the location where the author wrote the essay

C.

the main idea of the essay

D.

background information about the author

Answers

A the main idea of the essay

Task 3: THINK AND WRITE
Fill up the blank spaces below with bias and propaganda statements.
BIAS
PROPAGANDA
1.
(Testimonial)
James Reid is the new endorser
of a clothing line's newest
product
(Glittering Generalities)
2. There is no disputing when
it comes to choice.
3. Good governance is people (Plain Folks)
governance
(Bandwagon)
Nine (9) out of 10 dentists
recommend this toothpaste!
5.
(Bandwagon)
Join the crowd! Sign the petition
to save the forest trees.

Please answer please I really need this

Answers

Bias statementsJames Reid is the best choice to be selected for promoting the clothing line's newest product.This is the best toothpaste brand around and i recommend it to youSigning the petition to save the trees would be the best decision you would make today.Propaganda statementsBuying your clothes from us would be the best choice you are going to make.Vote for Mr Adams for Governor, he's the people's choice.

Bias has to do with the personal opinion of a person and how his prejudice for a particular thing or person is shown.

Prejudice on the other hand has to do with the preconceived notion about something, whether it is true or not and this is shown in stereotypes.

Read more about bias here:

https://brainly.com/question/4540984

Daffynitions for:

Momentous
Shoddy
Surly
Bogus
Tirade

Answers

Answer:

mo·men·tous

Anger of a superior quality and degree, appropriate to exalted characters and momentous occasions (i.e. 'the wrath of God', 'the day of wrath').

Shoddy

Ugly and terrible

Surly

Angry and annoying

Bogus

Fakey

Tirade

words about angry-ness

Explanation:

Definition

But what is the solstice exactly?

I did the main idea pls and two piece of evidence

Answers

Answer:

On two moments each year—what are called solstices—Earth's axis is tilted most closely toward the sun. The hemisphere tilted most toward our home star sees its longest day, while the hemisphere tilted away from the sun sees its longest night. that's as far north as you can go and still see the sun directly overhead.

Explanation:

hope it helps

What does this allusion reveal about Prufrock? He resents his lowly place in life. He sees himself as a minor character. He is an actor in his spare time.

Answers

The allusion in the poem "The Love Song of J. Alfred Prufrock" reveals the following about Prufrock:

2. He sees himself as a minor character.

Prufrock is the speaker in the poem "The Love Song of J. Alfred Prufrock," by T. S. Eliot. At a certain point, he alludes to Shakespeare's "Hamlet":

"No! I am not Prince Hamlet, nor was meant to be; Am an attendant lord, one that will do To swell a progress, start a scene or two —"

What he means by those lines is that he is just a minor character in life. He is not Hamlet, the main character, just someone to "start a scene or two."

Prufrock is an emotionally stunted man. Now that he is aging, he is even more fearful of approaching others, especially women.

He feels left out, as if others are main characters while he is just a minor one.

With that in mind, we can choose the second option as the one that best reveals the meaning of his allusion.

Learn more about Prufrock here:

https://brainly.com/question/1566140

Answer:

B

Explanation:

correct on Edge 2022

Which statement best explains why Twain uses reputation to advance his purpose

Answers

Answer:

The answer is:

C.) to stress the beauty of the French landscape

Explanation:

I just took this test and the answer is right

Making a Butterfly Garden By: Matthew Ramirez 1Do you want butterflies in your garden? You can bring butterflies to your garden. Butterflies will come to your garden if you give them the things they need. Butterflies need food to eat. They need places to rest. They also need water to drink. 2The first step you should take is to plant flowers. Butterflies eat the sweet liquid in flowers. They like bright flowers. They like the colors red, yellow, orange, pink, and purple. 3Next, give the butterflies places to rest. Butterflies can rest on the flowers you plant. Butterflies like to sit in the sun. You should plant some flowers in the sun. They also like to sit on rocks. You should put flat rocks in your garden. The butterflies will like sitting on it. 4Finally, put water in your garden. Butterflies need to drink water just like people do. You can put a bird bath in your garden. You could also keep a pan of water in your garden. 5Butterflies could make your garden more beautiful. Try to bring some to your garden today!

Why is the passage MOST LIKELY organized into short paragraphs?

A) The paragraphs help to list each step in making a butterfly garden.

B) The paragraphs let the reader know the passage tells a fictional story.

C) The short paragraphs indicate that the reader is supposed to be comical.

D) The author prefers to write using short paragraphs, and can't write any other way.

Answers

Answer:

D

Explanation:

Answer:

D

Explanation:

Other Questions
sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. Steam Workshop Downloader