Which of the following are formed during photosynthesis?A. C6H1206 and 0₂OB. C₂H4O2 and 02OC. C6H1206 and H₂0OD. C₂H4O2 and H₂O

Answers

Answer 1

A. C₆H₁₂O₆ and O₂ are formed during photosynthesis.

6CO₂+6H₂O→C₆H₁₂O₆+6O₂; Photosynthesis' Reaction

Photosynthesis is a prominent reaction in green plants. Chlorophyll is the main pigment responsible for trapping sunlight. Stomata primarily capture carbon dioxide, one of the raw materials. Water and oxygen are the by-products of it.

Glucose is the primary product formed in the process. The photosynthetic products are transported as sucrose and stored as starch.

Photosynthesis is divided into Light reaction and Dark reaction, on the basis of the availability of light. Carbon dioxide is reduced to carbohydrates and water is oxidized to oxygen.

Learn more about Photosynthesis:

https://brainly.com/question/19160081


Related Questions

What analogy is used to describe how cell replication is regulated?

Answers

Driving a car might be one common analogy used to describe how cell replication is regulated.

What is the cell replication cycle?

The cell replication cycle is a sharply regulated process that resembles driving a car because there are many steps that can be stopped to continue with the process.

In the case of the cell cycle, there are major points of control that regulate the progression through this process which involve the Growth 1 phase (G1), the synthesis S phase and the Growth 2 (G2) phase. All these phases in the cell cycle are regulated by the presence of cyclin proteins that are phosphorylated by cyclin-dependent kinases in order to continue with the cell cycle.

Therefore, with this data, we can see that the cell cycle is a sharply regulated process that has several points of control where the cell recognizes that all is fine to continue with the process.

Learn more about the cell cycle here:

https://brainly.com/question/5034994

#SPJ1

Cutting is the easy technology to produce large number of vegetative seedlings at a time . How explain

Answers

Answer:

Many plants, especially horticultural and garden varieties, are propagated through cuttings; by the use of new techniques, many other plants formerly not susceptible to propagation through cuttings have more successfully reproduced. The plants that develop from cuttings are clones.

Explanation:

The cutting method is a technique of vegetative reproduction in plants. In this method, a branch of the stem is cut out from the plant and buried in the soil. New leaves arise from the nodes in the stem and the new roots also develop giving rise to a whole new plant. Example- rose, sugarcane. Cuttings can be made from any part of the plant. Most frequently, however, either a stem or leaf is used. A stem cutting includes a piece of stem plus any attached leaves or buds. Thus, stem cutting only needs to form new roots to be a complete, independent plant. A cutting is a section of plants such as a modified stem, leaf, or root used for vegetative propagation that forms either adventitious shoots, adventitious roots (stem and single node cuttings), or both (root and leaf cuttings). These are long pieces of roots which are used to artificially propagate new plants. For example, lemon, orange, blackberry, boysenberry, raspberry, etc. Cutting gives young children independent movements of each finger. Cutting with scissors works on the separation of two sides of the hand and strengthens hand muscles. Bilateral coordination is also addressed when they have to hold the scissors in one hand and the paper in the other. The four main types of stem cuttings are herbaceous, softwood, semi-hardwood, and hardwood. These terms reflect the growth stage of the stock plant, which is one of the most important factors influencing whether or not cuttings will root. You will get greater uniformity (clones) of your plants. The plant will reach maturity at an earlier age. When a recipe specifies how to cut an ingredient, it is important to follow the instructions because using the proper cutting technique will affect the dishes cooking time and will help ensure the food cooks more evenly and maximizes flavour.

Cutting is the easy technology to produce large number of vegetative seedlings at a time because the plants which are not susceptible can be easily propagated through this.

What is Vegetative propagation?

Many plants, especially those of horticultural and garden varieties, are propagated through cuttings. By the use of new techniques, many of the other plants formerly those which are not susceptible to the propagation of plants through cuttings which have more successfully reproduced. The plants that develop from cuttings are clones.

Most of the plant cuttings include stem pieces, and these have no root system of their own, and are therefore likely to die from dehydration of plant parts if the proper conditions are not met. Plant cuttings require a moist medium, which, however, cannot be too wet as this can rot the plant cutting. A number of media which are used in this process include however are not limited to soil, perlite, expanded clay pellets, and even water if given the right conditions. Most of the succulent cuttings can be left in open air until the cut surface dries, which may improve the formation of root when the cutting is later planted.

Learn more about Vegetative Propagation here:

https://brainly.com/question/1213600

#SPJ2

Name and describe at least two applications for population estimates.

Answers

7.1 billion and 3.1 trillion

Hi I’m not sure if I’m right with this Question I need some help please and thank u

Answers

The reason why these cells can develop too many tasks at once, beyond having the specific genes expressed, is that they can constantly produce usable forms of energy in form of ATP by using glucose in cellular respiration. So the correct answer to this question is the final one.

During what phase of the cell cycle do chromosomes replicate?

Answers

The phase of the cell cycle in which chromosomes replicate is the S phase.

What is Cell cycle?

This is referred to as the series of events that take place in a cell during the process of reproduction an d in this scenario , the parent cells divide which gives rise to two daughter cells. Chromosome on the other hand is a thread like structure which is made up of DNA.

The S phase occurs between G₁ phase and G₂ phase and is an important process in mitosis as the DNA in the nucleus are synthesized and the traits present are usually passed to the offspring.

Read more about Cell division here https://brainly.com/question/796780

#SPJ1

Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22. On which human chromosome, arm, and position can the recipe for this protein be found?

Answers

Generally , these proteins are located in the nuclear lamina.

What is Lamin A ?

Instructions for creating a number of slightly different proteins known as lamins are provided by the LMNA gene. Most of the cells in the body make lamin A and lamin C, the two main proteins produced by this gene. These proteins are constructed from a pattern of virtually identical protein building units (amino acids). Lamin A is longer than lamin C due to the minute variation in the sequence.

These proteins are specifically found in the nuclear lamina, a layer of intermediate filaments and other proteins that is connected to the nuclear envelope's inner membrane. The nuclear envelope controls how molecules enter and exit the nucleus.

Learn more about nuclear lamina from given link

https://brainly.com/question/14986847

#SPJ13

Enzymes_______activation energy and______up chemical reactions.
A. lower, speed
B. speed, lower
C. lower, slow

Answers

Answer:

A: lower, speed

Explanation:

Enzymes definitely speed up chemical reactions because they are proteins that act as biological catalysts. Catalysts speed up reactions without being used up themselves. They are reusable.

Lowering the activation energy makes the reaction faster because less energy is required to do the same task.

B and C do not make sense because speed activation energy doesn't make sense and slow up doesn't make sense either.

Given: dna codon chart, DNA sequence.DNA sequence given is: 3’ TAC CCC GAT AAA ATA CAT TTA GGA TCG CGA TGG TAT 5’How do you transcribe the DNA sequence into mRNA?And can you underline or highlight on the sequence the codons for Proline and Tyrosineand label which is which? Thanks

Answers

Step 1:

The process of DNA transcription occurs from the 5' to 3' being the DNA sequence in the correct order for transcription as follow:

5' TAT GGT AGC GCT AGG ATT TAC ATA AAA TAG CCC CAT 3'

Step 2:

Resulting in the mRNA:

5' AUA CCA UCG CGA UCC UAA AUG UAU UUU AUC GGG GUA 3'

- Being the nucleotide thymine replaced by uracil in the formation of the RNA strand.

Step 3:

The codons sequence that form proline and tyrosine are:

Proline: CCA;

Tyrosine: UAU.

which statement best describes an example of how climate change leads to decreased biodiversity?
A. Increased rains in dry regions cause more plants to grow,
increasing the ecosystem's resiliency.
B. High temperatures become more common farther from the
equator, leading to increased stability of the ecosystem.
C. Warmer arctic regions allow for increased animal populations,
changing the ecosystem's resiliency.
0
D. Sea levels rise due to increased temperatures, flooding coastal
areas and leading to an unstable ecosystem.

Answers

The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.

What is Ecosystem?

This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.

An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.

Read more about Ecosystem here https://brainly.com/question/842527

#SPJ1

Which action would most likely lead scientists to change or improve an existing scientific theory about evolution?

Answers

Answer: Gathering new evidence using new technologies or procedures most likely will lead scientists to change or improve an existing scientific theory (Option D).

Explanation:

Distinguish between monohybrid, dihybrid and test crosses.

Answers

In the monohybrid cross, the possible offspring of a cross between two organisms is evaluated, but only one characteristic is taken into account. While in the dihybrid cross two characteristics are evaluated.

However, unlike the monohybrid cross, in the dihybrid cross, combinations of alleles must be made in order to obtain all possible gametes and thus perform the punnet square properly. An example of a dihybrid cross and allele combination is shown in the following image:

Finally, a test cross refers to these two examples. A test cross taking into account only one trait is called a monohybrid cross. A test cross using 2 traits is a dihybrid cross.

How does active transport differ from all other forms of transportation?A. It shifts from high to lowB. It maintains homeostasisC. It creates an equilibrium shiftD. It requires energy

Answers

The correct answer is the letter D. It requires energy

*Active transport requires energy (ATP) in order to move molecules across the membrane. It needs energy since it moves molecules against a concentration gradient.

The process that allows molecules to move through a protein channel from an area of high concentration to low concentration.

A. Active Transport

B. Simple Diffusion

C. Osmosis

D. Facilitated Diffusion​

Answers

Answer: D. Facilitated Diffusion​

Explanation: Two classes of proteins that mediate facilitated diffusion are generally distinguished: carrier proteins and channel proteins.

describe how red blood cells are adapted for their function (2 marks)

Answers

The adaptations of red blood cells are no nucleus to accommodate more hemoglobin, biconcave shape to be able to pass through extremely small blood vessels, thin cell membrane to let oxygen diffuse faster, and presence of hemoglobin itself, that combines with oxygen to give off its red color.

found more than 400 different mutations in the PAH enzyme that are associated with PKU disease. how many alleles can be found in one individual?

Answers

you can only have 2 alleles per gene

When a trait has three or more distinct alleles, we refer to it as having multiple alleles inheritance. The human ABO blood type alleles/trait is an example of a trait with multiple alleles.

Help asap…

1. In which organs is food moved through by peristalsis? (Choose all that apply)

A.stomach
B.small intestine
C.esophagus
D.liver

2. What is the substance produced by the liver that is necessary to break down fat drops into smaller fat drops?

A.bile
B.enzyme
C.acid
D.mucus

Answers

Answer:

1. A,B,C

2. A

Explanation:

1. Peristalsis is the automatic wave-like movement of the muscles that line your gastrointestinal tract. Peristalsis moves food through your digestive system, beginning in your throat when you swallow and continuing through your esophagus, stomach and intestines while you digest.

2. Bile is a fluid that is made and released by the liver and stored in the gallbladder. Bile helps with digestion. It breaks down fats into fatty acids, which can be taken into the body by the digestive tract.

Which relationship is an example of predation?

Answers

An example of predation is D) Chickens peck at the ground and eat many types of insects.

Predation is a type of biological interaction in which a predator feeds on its prey. In the above example, chickens are the predators that make insects their prey.

In order for an ecosystem to be healthy, predators are essential. There is more food available for the survival and success of healthy prey species after predators take away vulnerable prey, such as the young, old, sick, injured, or very young. Predators also aid in reducing the size of prey populations, which slows the spread of illness.

What are the types of biological interaction?

Mutualism, commensalism, competition, and predation are the four basic forms of two-way biological interactions between species found in ecological webs (which include herbivory and parasitism).

Therefore, D) Chickens pecking at the ground and eating many types of insects is an example of predation.

To know more about biological interaction, click on https://brainly.com/question/28459604

#SPJ9

According to the theory of endosymbiosis, a mitochondria or chloroplast may have been a prey species and was engulfed by a cell or it could have been a parasite that entered the cell. WHY do scientists think that the cell did not destroy or remove these structures?

A: because they competed with the cell

B: because the structures benefited the cell​

Answers

Answer:

Because the structures benefited the cell​

Explanation:

Scientists believe that host cells and bacteria formed a mutually beneficial endosymbiotic relationship when the host cells ingested aerobic bacteria and cyanobacteria but did not destroy them.

What’s the correct answer answer asap for brainlist

Answers

Actin and myosin  come in and out of the cell to make it thicker or thinner which changes its length.

The correct option is B.

What is myosin in muscle contraction?

Myosin contracts the myofibrils by sliding along myosin within the sarcomere, a process that demands ATP. Numerous molecules, including as calcium, troponin, and tropomyosin, that control muscle contractions and motor behaviors have also been found by researchers.

What are the uses of myosin?

All hundred billion cells that make up the human body depend on myosins for growth and tissue creation, respiration, reproduction, communication, reshaping, and motion. Furthermore, myosins allow the quick invasion of bacteria, viruses, and parasites into eukaryotes host cells.

To know more about Myosin visit:

https://brainly.com/question/14988876

#SPJ13

The complete question is-

What is involve in a muscle contraction ?

A-The gap junction between the cells pull them close together  which shortens the muscle.

B-Actin and myosin  come in and out of the cell to make it thicker or thinner which changes its length.

C-Myofibrils in the muscle shorten ands lengthen to make the muscle D-contract and extend.

D-The extra nuclei trigger nerve to stiffen  the muscles  and make them shorter.

please help. Due in the morning.​

Answers

Answer: See below

Explanation:

The Male P1 Mouse: BB

The Female P1 Mouse: bb

The first photo shows the genotype of the F1 generation, they are now heterozygous because they contain different alleles (Bb).

The black B is the dominant trait so they will all be black because they all have that B allele.

The second photo shows the F2 generation and shows that one of the four offspring would have bb which would be white while all others will be black.

Given the structure of protein, why is the energy that is released as heat during chemical reactions not useable for work in biological systems?

Answers

Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.

Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.

Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.

In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.

I’m am unsure of the steps to solve this and what to get for the answer

Answers

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

The cerebral cortex is divided into two halves called cerebral hemispheres. each cerebral hemisphere has three lobes, the parietal lobe, the frontal lobe, and the occipital lobe.

a. True
b. False

Answers

False there are four lobes

The cerebral hemisphere has four lobes, so the above statement is false.

What is Cerebral cortex?

The Cerebral cortex also known as gray matter which comprises the brain’s outermost layer of nerve cell tissue and has a wrinkled appearance from its many folds and grooves. These folds have many groups called sulci and raised areas are called gyri.

These folds add to the surface area of cerebral cortex which allows large amount of information to be processed by Nerve cells. Cerebral cortex makes about half of the total brain mass. It consists of 6 layers which contains approximately 14 to 16 billion Nerve cells, thickness of about 0. 2 mm to 4 mm.

It is divided into four lobes. They are Frontal, Parietal, Temporal and Occipital which is responsible for processing different types of information.

It consist of nerve cell bodies which include end portion of Nerve cells called dendrites that's why it is also called gray matter. These dendrites receive chemical message from another cell cerebral cortex. It is gray in colour because lack of fatty covering of nerve which is called my myelin.

Thus, the cerebral hemisphere has four lobes, so the above statement is false.

Learn more about Cerebral hemisphere, here:

https://brainly.com/question/13543441

#SPJ12

What’s the correct answer answer asap for brainlist
Is it C?

Answers

The way in which a neuron goes from a negative charge to positive charge is that: C. an action potential opens the gate sodium channels stay behind, and floods the cell with positive ions.

What is a neuron?

In Science, a neuron can be defined as a nerve cell that is saddled with the responsibility of transmitting electrical signal (impulses) down an axon across a cellular membrane of the body of a living organism, especially through an action potential.

Generally speaking, the neuron comprises different parts and are of different types which include the following:

Cell bodyMyelinSensory neuronDendritesMotor neuronReceptor neuronAxonAction potential

What is an action potential?

An action potential simply refers to a sudden, fast change in electrical (voltage) potential with respect to the transmission of an impulse to a receptor, across a cellular membrane such as the following:

A nerve cellA muscle cell

In conclusion, a neuron changes from a negative charge to positive charge because a resting potential neuron has a negative charge while sodium ions have a positive charge.

Read more on neurons here: brainly.com/question/13076783

#SPJ1

Question 11
You read a news report about a recent large volcanic eruption. It was reported
that the eruption was highly explosive with viscous lava. What type of volcano was
likely responsible for the eruption?
(Hint: the most explosive, dangerous kind)
A cinder cone

B composite

Cshield

Answers

The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.

What is volcano?

A volcano has been defined as the hill or mountain or it has an opening in a planet or moon's crust from which molten rock, warm gases, and materials erupt. It has a landform where molten rocks erupt through the surface of the planet and volcano moutains open downwards to molten rocks.

According to Geologists there's are four types of volcanoes and these are lava domes, shield volcanoes, composite volcanoes, and cinder cones.

Therefore, The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.

Learn more about volcano on:

https://brainly.com/question/13428729

#SPJ1

A small group of foxes moved to a new environment, starting a new population.They began with a population of 10 foxes, and over the course of 2 years expandinto a population of 40. The population increased rapidly, but now food starts tobecome harder to find, and much of the living space is occupied. The populationstill grows, but at a decreased rate. Which part of the growth phase is thispopulation currently in?A. ExponentialB. LagC. TransitionalD. Plateau

Answers

When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.

When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.

Looking at your data, which color light was needed the most by chlorophyll during photosynthesis? (Hint: which color light was absorbed the most in your experiment?) Question 9 options:redbluegreen

Answers

Chlorophyl absorbs the light at both endpoints of the visual expectrum, which means that ir absorbs the light of the blue and red wavelenghts.

The red wavelength is absorved on a higher rate than the blue wavelength.

A gecko, which has a spinal column and climb walls, can be classified as what type of animal? An ArachnidAn AmphibianAn invertebrateA vertebrate

Answers

Given the characteristics provided: a spinal column and climbing walls; we can classify the gecko as a vertebrate because it has a spinal column (option D).

To make a more specific classification, we would need to know more characteristics of the gecko.

primates have long growth and development periods because:

Answers

Primates have long growth and development periods because: they have larger brains and higher intelligence as compared to other organisms.

Primates is the order of the class Mammalia. They are different and more advanced from all the other animals. They have more intelligence, five-digit feet and hand, more vision power than smelling power and slower growth. Their life span is also very large.

Brain is the most complex and largest organ of the body. It is the master regulator of all the actions of the body. The brain is divided into left and right hemispheres. There are three sections of the brain: forebrain, midbrain and hindbrain.

To know more about brain, here

brainly.com/question/5361122

#SPJ1

what is the process that allows CO2 and glucose to enters the plants cells chloroplast

Answers

Answer: photosynthesis

Explanation:

photosynthesis

Plants use energy from sunlight to turn water and carbon dioxide into an energy-rich sugar called glucose. This process is called photosynthesis, which means “making things with light”. Photosynthesis takes place inside capsules in the leaf cells, called CHLOROPLASTS.

Other Questions
Last winter it snowed 5 inches in December 17 inches in January 13 inches in February and 2 inches in March how much snow fell during the entire winter In a survey, 300 adults and children were asked whether they preferredhamburgers or pizza. The survey data are shown in the relative frequencytable. help meeeeeeeeee pleaseee !!!!! A plane flies from Oahu and back. Flying to Oahu the plane is flying against the wind and the trip takes 6 hours. On the way back the plane flies with the wind and it takes 5 hours. If the distance one way is 900 miles, what is the speed of the plane in still air and the speed of the wind? What non-manual markers to use when signing your birthday in american sign language. both qing china and tokugawa japan adopted a restrictive policy regarding christianity and foreign trade, and yet both were open to some influence of western knowledge. what were the rationale behind these policies? how did the jesuits and the dutch impact each society differently? what accounted for such differences? The Han dynasty was considered a golden age of China. Likewise, the Tang dynasty is also often considered a golden age of China. What does the term golden age mean? List three things that both these dynasties might have had in common (other than the territory they covered) that would make them golden ages. The _______ would activate our fight or - flight response to encountering a bear on our walk.Referring to what section of the brain Consider the hypothetical thermochemical equation 3 A + B 2 C for which H = 65.5 kJ/mol.What would H, in kJ/mol, be for the reaction 2 C 3 A + B? Eddie brought his DVD set to the secondhand store to sell he was paid for all three DVDs in the set before he left Eddie used $15.70 of his earnings to purchase a pair of headphones had $2.30 remaining which equation can you use to find the amount of money Eddie received for each DVD 15.70(d-3)=2.303d-15.70=2.3015.70d-3=2.303(d-15.70)=2.30 In a series RLC circuit, the phase difference between the current in the capacitor and the current in the resistor is? How does Phaethon's character influence the climax of the story andthe resolution of the conflict? Which lines in the following paragraphs describe the story'sclimax? Carter wants to use the model above to solve 273 13. Explain how he would find parts A, B, and C of the model. The Proposed East West Metro Takes you to the other side of the river? If one nerve stimulus arrives at a muscle fiber so soon that the fiber has only partially relaxed from the previous twitch, the most likely result will be __________. someone who believes they are experiencing harassment and/or bullying should: 1 avoid telling the person harassing or bullying to stop 2 wait to seek emotional support from friends, family or school until they have enough evidence of bullying 3 avoid social events 4 seek resolutions and put complaints on record I need help ASAP I have a F in my class Suppose U = {1, 2, 3, 4, 5, 6, 7, 8} is the universal set and P = {2, 4, 6, 8}. What is P' ? {2, 4, 6, 8}{1, 2, 3, 4, 5, 6, 7, 8}{1, 3, 5, 7}{1, 3, 5, 7, 8} What are three modern inventions that could not have been invented without the earlier contributions of sir isaac newton?. troy is interested in buying a particular stock whose current dividend per share is $1.10. troy estimates that the current dividend per share will increase at a rate of 3.25% per year forever. if troy's estimates are correct, what is the best estimate of the stock price per share if the required rate of return is 13.00%.