Which of the following cannot be used to produce electricity?
a) Biomass
b) Wind
c) Geothrmal
d) Stones

Answers

Answer 1

Answer: D 100% I KNOW :D

Explanation:

Answer 2

Answer:

D

Explanation:

stones don't have electricity it is just something found in nature.


Related Questions

An organism must have provided all of the following to survive EXCEPT

Answers

Answer:

The answer is the one that is not on this list

List of criteria for a living organism:

1.) Can Reproduce

2.) Goes through homeostasis

3.) Needs Energy

4.) Is organized/ has cells

5.) Grows and Develops

6.) Responds to stimuli.

Explanation:

How is gravity simulated on the hermes spacecraft?.

Answers

Answer:

A section of the spacecraft is slowly rotated in order to simulate the force of gravity.

Explanation:

The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.

.......................................................
..........................................................
///////////////////////////

Answers

Answer:

2 2/9

Explanation:

5 x 4/9

20/9

divide 20 by 9

= 2 2/9

Answer:

2[tex]\frac{2}{9}[/tex] is the answer

Explanation:

hope this helps

what is the approximate time of death if the body temperature was 10 degrees celcius

Answers

Answer:

I think it would be 2 to 3 days am so sorry if am wrong

Explanation:

F = c * {9/5} + 32 is the equation

F = 10 * {9/5}

F = 10 * 1.8

F = 18

Under what circumstances would a food pyramid be a more useful model than a food chain?

Answers

Answer:

A food chain represents the linear relationship between organisms for food. On the other hand, a food pyramid represents the optimal number of servings to be eaten each day from each of the basic food groups.

Food pyramid represents the total number of food to be eaten each day from each of the basic food groups .A food chain represents the linear relationship between organisms for food.

What is food chain?

Food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another.

What is food pyramid?

Food pyramid is a depiction of the optimal number of servings to be eaten each day from each of the basic food groups.

To learn more about Food pyramid , here

https://brainly.com/question/17234521

#SPJ2

how much water is in our bodies

Answers

Answer:

60%

Explanation:

Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.

I hope this helps you

:)

Can a cell be an organism on its own

Answers

Conclusion. Cells are the smallest common denominator of life. Some cells are organisms unto themselves; others are part of multicellular organisms. All cells are made from the same major classes of organic molecules: nucleic acids, proteins, carbohydrates, and lipids.

nah cant

Explanation:

cuz and organisms definition is:

an individual animal, plant, or single-celled life form.

SINGLE-celled life form meaning all the cells are the same

hope this helps :D

The weight of an object also depends on

Answers

Answer:

the value of the acceleration of gravity.

Explanation:

how do homologous structures show common ancestry?

Answers

Answer:

Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features). Similarities and differences among biological molecules (e.g., in the DNA sequence of genes) can be used to determine species' relatedness.

Explanation:

The correct statement is C. They demonstrate how different species differ and which creature created the structure first. Anatomical characteristics observed in several species that have a common ancestor include what are known as homologous structures.

Although these structures may have diverse purposes in many creatures, their similarities suggest that they had an ancestor.

The anatomical characteristics of several creatures may be compared to find homologous structures and deduce evolutionary links.

Because diverse kinds of creatures have homologous features, it is likely that these qualities were passed down from a common ancestor.

Similarity levels and common anatomical patterns might shed light on a species' evolutionary path.

To know more about Anatomical characteristics:

https://brainly.com/question/32344097

#SPJ2

What are the thin fibers of the human nervous system called?.

Answers

Description of the nervous system
Neurons send signals to other cells through thin fibers called axons, which cause chemicals known as neurotransmitters to be released at junctions called synapses

Answer:

Axons should be your answer.

Explanation:

The individual thin fibers in which neurons send signals to other cells are axons. When individual fibers are bundled together, it is called nerve fiber.

18 The size of a mouse population in a natural
ecosystem tends to remain relatively constant due to
A. the cycling of energy.
B. the lack of natural predators.
C. the increased numbers of decomposers.
D. the carrying capacity of the environment.

Answers

Answer:

D- the carrying capacity of the environment.

Explanation:

The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant. Therefore, option (D) is correct.

What is a limiting factor in a ecosystem?

Limiting factors are physical, biological, and ecological conditions that:

(1)  Limit the ecosystem's ability to sustain native plant and animal populations and to accommodate natural disturbances like floods;

(2) Limit the quality or availability of habitat that supports all life stages of  native species; and

(3)  Limit the ecosystem's ability to sustain the local tribal culture.

The only natural factor limiting the number of mice in the home is a scarcity of resources such as food. Therefore, The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant.

Learn more about carrying capacity, here:

https://brainly.com/question/2375972

#SPJ2

When two protein chains combine to form an active protein, the structural level is ________

Answers

When two protein chains combine to form an active protein, the structural level is quaternary.

What is a quaternary structure?

The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.

The quaternary protein structure refers to the different arrangements generated by different protein subunits.

The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.

Learn more about quaternary structure here:

https://brainly.com/question/5286438

When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

What do you mean by Proteins?

Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.

The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.

Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

To learn more about Protein structures, refer to the link:

https://brainly.com/question/14207491

#SPJ4

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Answers

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Hello people ~
The interspecific interaction in which one partner is benefitted and the other is unaffected (neutral), is called
(a) amensalism
(b) mutualism
(c) competition
(d) commensalism

Answers

Answer:

it is called commensalism

Explanation:

because it benefits one and other derives neither benefit nor harm

Answer:

Commensalism

Explanation:

It is a symbiotic relationship in which one benefitted and the other one is neither benefitted nor harmed..

where is the digestive and circulatory system connected?
a. alveoil
b. villi
c. artery
d. pancreas​

Answers

Answer:

The products of the digestive system are actually tied directly to the circulatory system in that the organs of the digestive system are used to turn ingested food into products that can be absorbed by the blood and then carried to other organs for use as energy or other functions.

Explanation:

Answer:

b) Villi

Explanation:

The digestive and circulatory system is connected by villi.

It is the tiny finger-like projections that line inside of small intestine. Therefore, option (b) is the answer.

There was a change in the environment between generations 10 and 30. the change likely .

Answers

These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.

Every era of organisms inherits trends owned via way of means of their mother and father via genes. Changes (known as mutations) in this gene will new trends withinside the offspring of an organism. In an organism's populace, a few trends become greater common, even as others will disappear.This technique is known as herbal selection. The profits of greater offspring than the variety of mother and father at the side of the inheritance.

What are heredity mutations?

Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.

Thus it is well explained.

To learn more about evolution refer to the link :

https://brainly.com/question/1144962

Answer:

✔ favored trait A

Explanation:

An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.

It decreased in frequency over time.

It became extinct.

It is carried on a recessive allele.

There was a change in the environment between generations 10 and 30. The change likely

✔ favored trait A.

In what phase of meiosis does crossing-over take place? why is crossing over important?.

Answers

Answer:

prophase I

Explanation:

This is important because it increases genetic variation.

hope this helps

pls mark brainliest

How is ocean acidification important to the world?

Answers

Answer:

Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.

A rural, forested area receives a lot of rain in a short amount of time. What would most likely cause potential flooding in the area?

Answers

The most likely cause potential flooding in the area will be saturation of the ground with water.

What is Flooding?

This is defined as a situation in which an overflow of water submerges land that is usually dry.

When the ground is already saturated with water, a forested area receiving a lot of rain in a short amount of time will lead to flooding.

Read more about Flooding here https://brainly.com/question/12686086

How are the bodies of the three animals similar to one another? How are they different?

Answers

Answer:

How are animals similar? All animals are made of many cells. Most animals can move on their own. Like all living things, animals grow, change, reproduce, and respond to their environment.

Animals are made up of several cells. Most animals have independent movement. Animals develop, transform, reproduce, and react to their surroundings like all other living creatures do.

What are considered as animals?

Any eukaryotic multicellular organism of the biological kingdom Animalia is referred to as an animal.

The majority of creatures in this kingdom lack a cell wall, are heterotrophic, motile, have specialised sensory organs, and originate from blastulae during embryonic development.

According to some, the fundamental distinctions between humans and other animal species are our capacity for complex reasoning, our use of complex language.

Also, the capacity for problem-solving, and the capacity for introspection (this means describing your own thoughts and feelings).

Multiple cells make up an animal. The majority of animals can move on their own. Like all other living things, animals grow, change, reproduce, and respond to their surroundings.

Thus, this way, many animals contrasts each other.

For more details regarding animals, visit:

https://brainly.com/question/12985710

#SPJ2

The physical appearance of an organism is known as its
A. genotype
B. phenotype
C. allele
D. testcross

Answers

Answer:

B.Phenotype

Explanation:

The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior. An organism's phenotype is determined by its genotype, which is the set of genes the organism carries, as well as by environmental influences upon these genes.

A blood sample containing erythrocytes with only surface antigen B on the plasma membrane is ABO blood type ______.

Answers

Answer:

ABO blood type B

Explanation:

The blood sample only contains B as a surface antigen (simplified as the sugars clinging to the blood embedded halfway inside) making any other blood type unviable. B would be the only option.

What do we call a natural resource if it can be used up faster than it can be replaced?

a: depletable
b: renewable
c: sustainable

Answers

Depletable

Renewable is energy we can “renew” or “get back”.

Sustainable is if it “sustains” or works for the present and doesn’t affect the future.

Hope this helps! :)

Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel is called __________ vascular catheterization.

Answers

It is called central vascular catheterization

Importance of catheterization

Catheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.

Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.

There are different types of vascular catheterization which include:

Arteriovenous (AV) fistula,

Arteriovenous (AV) graft and

Central venous catheter (CVC)

Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.

Learn more about catheterization here:

https://brainly.com/question/3911876

In a population of pea plants such as the one below, bees and other pollinators prefer to land on purple colored flowers. Over generations, more and more purple flowers successfully reproduce due to this pollinator preference. Which of the following statements accurately describes what is happening to the pea plants over time?



Question 2 options:

Natural selection causes evolution in the population of pea plants and leads to increased overall variation.


Natural selection causes evolution of individual pea plants and leads to increased overall variation.


Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.


Natural selection causes evolution of individual pea plants and leads to an increase in favorable adaptations.

Answers

Answer:

Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.

Explanation:

The flowers will evolve to keep that purple trait in order to continue their population growth, hence why it is not individual evolution but as a population. Also since the purple color is a favorable trait it will lead to an increase in favorable adaptations and will decrease variation.

Which of the following best explains why deforestation increases the risk of floods in an area? a. Tree leaves catch and retain rain water. B. Trees block the free flow of water. C. Deforestation increases precipitation. D. Tree roots improve soil water retention. Please select the best answer from the choices provided A B C D.

Answers

Tree roots improve soil water retention

Deforestation increases the risk of floods in an area tree roots improve soil water retention.

Why does deforestation result in higher flood risk?

When deforestation takes place, the top layer of soil can be dislodged – this is also known as soil erosion.

When the top layer of soil is unstable, it is unable to retain any of the water that falls on it, resulting in increased surface run-off, which, in turn, increases the risk of flooding.

Thus, option "D" is correct.

To learn more about deforestation click here:

https://brainly.com/question/17178423

Purple petal color in pea plants is dominant to white petal color. Two heterozygous pea plants are crossed. What is the ratio of the offspring with white petals to the total number of offspring?

Answers

Answer:

25%

Explanation:

crossing two heterozygous plants would look like this Pp x Pp

making a chart

                      P     p

P              PP        Pp

p             Pp          pp

what this means is that the capital P isdminant so thats what will show is the dominant purple petal whereas lower case p is the ressecive white petal

this means 25% of offspring will be white :)

What makes erythrocytes unique from other cellular components of the blood?.

Answers

Answer:They contain hemoglobin.

Explanation:

How many chromosomes should be in each diploid cells after mitosis.

Answers

Answer:

46 chromosomes

Explanation:

46 chromosomes should be in each of these diploid cells after mitosis.

urgent help would be appreciated

Answers

I think it’s B xxx not sure tho
Other Questions
Solve the following equation for x.12x^2-36x=0 Please Answer this as fast as possible thanks How and why do organisms interact with one another? 1.anyJuan and Maria have noticed that all the frogs in their local pond have beenvery quiet recently. When they went to the pond, they could no longer hearof them. Then they saw a few of them were dead. To which agencyshould they report this problem?A. Florida Department of EducationB. Florida Department of Elder AffairsC. Florida Department of Veterans AffairsD. Florida Department of Environmental Protection Leslie tells her therapist that she constantly feels survivors guilt. What MOST likely happened in Leslies life to make her feel this way? A. Her sister died in a car accident, but Leslie did not. B. Leslie was in an abusive relationship for many years. C. Her parents were addicted to drugs when Leslie was young. D. Leslie went through the five stages of grief after her mom died. solve for x: -3(x-2)^2+17=0 round your answer to the nearest hundredth What is the new period if the pendulum is taken to a planet that has 4 times the mass and 4 times the radius of earth Help me please with my historyQuestion 11 (1 point) How did the Compromise of 1877 influence African American civil rights?Question 11 options:It required the federal government to propose new amendments that restricted African American rights, helping southern states overturn federal civil rights lawsIt allowed the federal government to continue to reshape southern society, increasing rights for African AmericansIt gave African Americans more roles in the federal government, giving them more power to reshape the SouthIt signaled that the federal government would refrain from actively supporting African American rights, allowing Southern Democrats to overturn political gains by African AmericansQuestion 12 (1 point) SavedHow did the United States government observe the 100th anniversary of the signing of the Declaration of Independence in 1876?Question 12 options:It did not celebrate the event, as it was still engaged in the Civil WarCelebratory events were held, but were largely subdued as the nation was still feeling divided and experiencing the effects of the Civil WarMajor celebrations were held throughout the country, acknowledging our country's united and national spiritIn celebration of the major milestone, political parties were abolished what is the difference between bacteria and cancer cells which of these was essential to the growth of a sharednational culture? 6 cm8 cm13 cm5.3 cm-What is the surface area? Fix the one word that is used incorrectly.SidneypaintsanddrawsgoodbutherrealtalentiscreativewritingShecanmakeeventhemostboringsituationsexcitingthroughheruseofwords Which of the following is equivalent to 1 and 5/8 Katie practiced her flute for 45 mins Then she ate a snack for 15 mins Next She watched televosion for 30 mins until 6:00 p.m at what time did Katie start practicing the flute A mother shared $400 amongst her three daughters Amy, Beatrice and Claire in the ratio of 3:2:5 respectively. How much money did Amy receive? - 11. Why will the kidnappers correspond through letters?A. Letters can't be traced.B. There are no telephonesC. They can't afford to pay for the telephone calls.D. None of the above How long can someone leave their belongings on your property. Measuring performance relative to planned objectives and standards is part of:. Which makes viral infections difficult to defeat? A. Macrophages work slowly.B. The immune system must attack the body's own cells.C. Viruses are attacked by a nonspecific immune response.D. Viruses live outside of cells. assignment- Fredrick Douglass What to the slaves is the Fourth of July 1) that questions does Douglass ask in his opening paragraph 2) what does he means when he asks, Your high independence only reveals the immeasurable distance between us.3) what do you think Zion is that Douglass is referring to?4) What does he mean when he says, "America is false to the past, false to the present, and solemnly binds herselfto be false in the future."5) What is he attacking in his speech?6) How does Frederick Douglass prove that slaves are viewed and treated as humans?7) What types of jobs prove that the slaves are men?8) In what ways are slaves punished according to Frederick Douglass?9) How does he employ/use "scorching irony"?10) how does he answer the central question that is What to the slaves is your Fourth of July?