Which of these is a behavioral adaptation?

An anteater has a very long tongue to help it eat catch and eat ants.
An artic fox has white fur which helps it blend into the snow.
A mouse has 3–14 offspring at a time to increase the number that survive.
A brown bear hibernates and becomes inactive during winter.

Answers

Answer 1

Answer: Your answer would be  D

Explanation: Sorry if i get it wrong ! (but good luck and make sure to rate)

Answer 2

Answer:

D

Explanation:

because when it is winter

a bear hibernates in a cave

and eats lots of food so it

dosent starve after sleeping

for such a while.

Hope this helps

plz mark brainliest

if you would be so kind!

bye!


Related Questions

A 25.00 mL sample of the ammonia solution
was accurately diluted to 250.0 mL. A 25.00mL
aliquot of the diluted ammonia solution was
placed in a conical flask. Indicator was then added
and the solution was titrated with 0.208 molL-1
hydrochloric acid. The indicator changed colour
permanently when 19.64 mL of the acid had been
added. Calculate the concentration of ammonia in
the original solution.

Answers

Answer:

1.634 molL-1

Explanation:

The mol ration between NH3 and HCl is 1 : 1

Using Ca Va / Cb Vb = Na / Nb   where a = acid and b = base

Na = 1

Nb = 1

Ca = 0.208 molL-1

Cb = ?

Va = 19.64 mL

Vb = 25.00mL

Solving for Cb

Cb = Ca Va / Vb

Cb = 0.208 * 19.64 / 25.0

Cb = 0.1634 molL-1 (Concentration of diluted ammonia solution)

Using the dilution equation;

C1V1 = C2V2

Initial Concentration, C1 = ?

Initial Volume, V1 = 25.00 mL

Final Volume, V2 =  250 mL

Final Concentration, C2 = 0.1634 molL-1

Solving for C1;

C1 = C2 * V2 / V1

C1 = 0.1634 * 250 / 25.00

C1 = 1.634 molL-1

What is the name of this hydrocarbon?

Answers

Answer:In the given molecule the methyl group is attached at the second carbon atom of the parent chain. Therefore the name of hydrocarbon is 2-methylbutane.

Explanation:

Use a scientific calculator to calculate [H+] for the following pH values:

7 (a neutral solution)

5.6 (unpolluted rainwater)

3.7 (first acid rain sample in North America)

How many times higher is the concentration of H+ in the Hubbard Brook sample than in unpolluted rainwater?

Answers

Answer:

pH = 7 ⇒ [H⁺] = 1.0x10⁻⁷ M

pH = 5.6 ⇒ [H⁺] = 2.5x10⁻⁶ M

pH = 3.7 ⇒ [H⁺] = 2.0x10⁻⁴ M

H⁺ concentration in the Hubbard Brook sample is 80 times higher than in unpolluted rainwater.

Explanation:

To answer this problem we need to keep in mind the definition of pH:

pH = -log[H⁺]

Meaning that after isolating [H⁺] we're left with:

[H⁺] = [tex]10^{-pH}[/tex]

Now we proceed to calculate [H⁺] for the given pHs:

pH = 7 ⇒ [H⁺] = [tex]10^{-7}[/tex] = 1.0x10⁻⁷ MpH = 5.6 ⇒ [H⁺] = [tex]10^{-5.6}[/tex] = 2.5x10⁻⁶ MpH = 3.7 ⇒ [H⁺] = [tex]10^{-3.7}[/tex] = 2.0x10⁻⁴ M

Finally we calculate how many times higher is [H⁺] when pH = 3.7 than when pH = 5.6.

2.0x10⁻⁴ / 2.5x10⁻⁶ = 80

Answer:

1. 7 (a neutral solution)

Answer: 10-7= 0.0000001 moles per liter

2. 5.6 (unpolluted rainwater)

Answer: 10-5.6 = 0.0000025 moles per liter

3. 3.7 (first acid rain sample in North America)

Answer: 10-3.7 = 0.00020 moles per liter

The concentration of H+ in the Hubbard Brook sample is 0.00020/0.0000025, which is 80 times higher than the H+ concentration in unpolluted rainwater.

Explanation: -

Which equation is correctly balanced?
A) CaO + 2H2O + Ca(OH)2
B) NH3 + 202 → HNO3 + H20
C) Ca(OH)2 + 2H3PO4 → Ca3(PO4)2 + 3H2O
D) Cu + H2SO4 → CuSO4 + H2O + SO2

Answers

A seems to be the balanced equations.

All the other equations do not have a “equilibrium” or balanced equation.

Hope this helps! :)

CaO + 2H2O + Ca(OH)2 is a balance chemical equation. Therefore, option A is correct.

What is balance chemical equation ?

A balanced chemical equation is one that has the same number of atoms of each type in the reaction on both the reactant and product sides. In a balanced chemical equation, both the mass and the change are equal.

When a chemical reaction occurs, the mass of the products should be equal to the mass of the reactants, according to the law of conservation of mass. As a result, the number of atoms in each element remains constant during the chemical reaction. As a result, the chemical equation must be corrected.

The chemical equation is said to be balanced if there are no inequalities. Every element in this example now has an equal number of atoms on both the reactant and product sides.

Thus, option A is correct.

To learn more about balance chemical equation, follow the link;

https://brainly.com/question/28294176

#SPJ2

Why do power plants emit such a high percentage of pollutants?

Answers

They burn fossil fuels, which releases huge amounts of sulfur dioxide and nitrogen oxide that pollute the air. ... Two thirds of all sulfur dioxide and more than one third of all nitrogen oxides that pollute the air.

They burn fossil fuels

please everyone do this and send me​

Answers

Answer: question 2 is (a) (25+273)k=298k(b) (373+273)k=646k

question 5 is 25 degree Celsius

question 1 is

a = (293-273) =20 degree Celsius

b = (470-273)=197 degree Celsius

question 3 is

a = naphthalene ball undergo sublimation due to which it convert directly into vapour and disappear into air without leaving any solid

b = the participle of perfume diffuse rapidly into air and its smell can be felt while sitting serval metre away

question 4 isthe force of allraction between the particles increases as we go from liquid to gas so the required order is : Oxygen< water< sugar

I hope it is helpful to you

A case of paper has a mass of 2000 g. A case of paper contains 10 reams of paper. One ream of paper is 500 sheets. What is the mass, in grams, of 50 sheets of paper?

Answers

Answer:

s8sooooosoossososososkdk

potassium hydroxide , sodium chloride, sodium hydroxide ,calcium chloride , sodium bicarbonate write molecular formula​

Answers

✧ [tex] \underline{ \underline{ \large{ \tt{A \: N \:S \: W \: E \: R}}}} : [/tex]

[tex] \underline{ \underline{ \large{ \text{Molecular \: Formulaes}}}} : [/tex]

⇾ [tex] \large{ \text{Potassium \: Hydroxide : K \: OH}}[/tex]

⇾ [tex] \large{ \text{Sodium \: Chloride : NaCl}}[/tex]

⇾ [tex] \large{ \text{Sodium \: Hydroxide : NaOH}}[/tex]

⇾ [tex] \large{ \text{Calcium \: Chloride : CaCl}}[/tex]

⇾ [tex] \large{ \text{Sodium \: Bicarbonate} : \tt{Na ( HCO)_{ 3} }}[/tex]

---------------------------------------------------------

☥ [tex] \underline{ \underline{ \large{ \tt{ \: E \: X\: P \: L\: A\: N \: A \: T \: I \: O \: N}}} }: [/tex]

[tex] \underline{ \underline{ \text{Writing \: a \: molecular \: formula}}} : [/tex]

To write a molecular formula , the following steps are usually adopted only when we know the symbol and valencies of elements and radicals present in a molecule.

Step 1 : First , the name of the compound is written.

Step 2 : The symbols of basic and acidic radicals are written side by side.

Step 3 : The valency of each radical is written at the right upper corner of the symbol. The valency of one radical is transferred to another radical and it is written on the right hand side at the bottom corner. If necessary , L.C.M of the valencies us taken to get a simple whole number.

Step 4 : If a compound radical takes part in the molecular formula , the radical is enclosed in brackets and the valency number is written on the right side of the bracket at the bottom of the formula.

For instance :

[tex] \text{Calcium \: \: \: \: \: \: Sulphate}[/tex] [ compound ]

1. [tex] \sf{Ca \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: SO_{4} }[/tex] [ Symbol of basic and acidic radicals ]

2.We know : Valencies of calcium and sulphate are 2 and 2 respectively

3. [tex] \sf{Ca_{2} \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: (SO_{4} )_{2} }[/tex] [ Valencies are exchanged and compound radical is enclosed in bracket ]

4.[tex] \sf{CaSO_{4}}[/tex] [ L.C.M is taken to get molecular formula of calcium sulphate ]

Hope I helped ! ♡

Have a wonderful day / night ! ツ

☄ Let me know if you have any questions regarding my answer !

☥ [tex] \underline{ \underline{ \mathfrak{Carry \: On \: Learning}}}[/tex] !! ✎

▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁

The Earth's early atmosphere consisted of what

Answers

The Earth's early atmosphere consisted of Carrbon Dioxide, methane, sulphur, ammonia, nitrogen and smaller amounts (aprox. 0.05%) of other gases.

If you have 12 atoms of hydrogen before a chemical reaction, how many atoms of hydrogen will be present

Answers

Answer:

12 atoms of hydrogen will be present in the product

Explanation:

12 atoms of hydrogen will be present in the product because the law of conservation of mass states that mass is neither created nor destroyed in chemical reactions.

The law of conservation states that the mass of the element remains the same during the course of the reaction.

The law of reaction conformed by the following:-  

Mass of reactant Mass of product

According to the question, the amount of hydrogen is 12 atoms in the reactant and the amount will remain the same at the end of the reaction, which is a product that is 12 atoms

Hence, the amount remains the same in the reaction that is 12 atoms

For more information, refer to the link:-

brainly.com/question/2817451

When dissolved in water all acids will???

Answers

Answer:

When dissolved in water, acids donate hydrogen ions (H+). Hydrogen ions are hydrogen atoms that have lost an electron and now have just a proton, giving them a positive electrical charge. Bases, on the other hand, mixed with water yield hydroxide ions (OH-). If a solution has a high concentration of H+ ions, then it is acidic.

Explanation:

So b

What is the density of a book with a mass of 60g and a volume of 20 cm3? *

Answers

Answer:

[tex]3 g/cm^{3}[/tex]

Explanation:

Density is a measure of a substance's mass over its volume.

d = m/v

Therefore d = 60g/20cm3 = 3 g/cm3

What is the volume of an object that has a mass of 5.80 g and a density of 6.35 g/mL?

Answers

Answer:

1.09 mL

Explanation:

Density is a measure of a substance's mass over its volume.

d = m/v

We can rearrange the equation to solve for volume, using algebra.

v = d/m

Therefore v = 6.35/5.80 = 1.09 mL

Using the diagram , what is the intersection of plan ABCD and GC?

Answers

Answer:

C

Explanation:

When a line segment and a plane intersect, they intersect at a point. They both coincide on point C

Which characteristic of a planet describes whether the planet has a thick or thin layer of gas?
Atmosphere
Moons
Rings
Surface composition

Answers

Answer:

Atmoshphere!

Explanation:

I took the test and got a 100%! :) Hope this helps, plz mark brainliest!

in today's pandemic,how can you protect our ozone depletion?​

Answers

Answer:

if you want to protect our ozone depletion you have aerosol products that don't contain HCFCs and CFCs as stimulus or incitement

Explanation:

why you should use aerosol because when the liquid mixture is freeded or released from the aerosol the liquid propellant becomes a gas so this can easily break up the product into a fine haze or a mist hope its helpful have a good luck

What ratio of NaCN to HCN is needed to prepare a pH 9.40 buffer? (Ka of HCN is 4.9 × 10⁻¹⁰)

Answers

Answer: The ratio of NaCN to HCN is, 1.26

The diffusion of matter and energy in a liquid is slower than diffusion in a gas
True
O False

Answers

It is true

Hope this helps

how many moles is 130g of cocl2

Answers

Answer:

1.3142 mol CoCl2

Explanation:

Well, to answer this we need to find out how many grams are in a single mole of CoCl2. Two find that we need to get the molar mass of CoCl2

Co = 28.0101 g Co per mole

Cl = 35.453 * g Cl per mole

28.0101 + 2 * 35.453 = 98.9161 g CoCl2 per mole

Now, we divide:

130/98.9161 = 1.3142 mol CoCl2

There are 1.31 moles in 130grams of cobalt chloride (CoCl2). Details about how to convert mass to moles can be found below.

How to calculate number of moles?

The number of moles of a substance can be calculated by dividing the mass of the substance by its molar mass.

According to this question, there are 130g of CoCl2.

molar mass of CoCl2 = 28 + 35.5(2) = 99g/mol

moles = 130g ÷ 99g/mol

moles = 1.31 moles

Therefore, there are 1.31 moles in 130grams of cobalt chloride (CoCl2).

Learn more about number of moles at: https://brainly.com/question/14919968

160
140
120
100
Temperature (°C)
80
60
40
20
0
0
2 4 6 8
10 12 14 16 18 20 22 24 26
Time (min)
.
At what temp will this substance freeze? 70 CV
At what temp will this substance condense? 70 C
How long will it take to release the heat of vaporization? 3 min
What is the melting point? 70 C
In what physical state did this substance end? Gas
All cooling processes, including phase changes, are Exothermic
At 90 C, what phase of matter is this substance? Liquid

Answers

It’s 140 and it’s also 160

Which statement correctly describes the relationship between air temperature and air pressure?

-Warm air rises, creating an area of low pressure.

-Cool air sinks, creating an area of low pressure.

-Warm air sinks, creating an area of low pressure.

-Cool air rises, creating an area of low pressure.

Answers

Answer:

-Warm air sinks, creating an area of low pressure.

Explanation:

Heat will weigh more, than cool air!

Give one example of
a) Homogeneous mixture of two elements

Answers

Answer:

honey

Coffee

blood

Explanation:

These components are uniformly distrubuted and these cannot be seperated unlike heterogeneous

Water (Hydrogen and oxygen)
Ammonia (nitrogen and hydrogen)
Methane(carbon and hydrogen)
Table salt ( sodium and chlorine)

Revise this statement to make it true:
Running water makes rock edges very sharp and pointy.
NEED HELP NOW PLEASE!! WHOEVER ANSWERS FIRST GETS BRAINIEST!!! No links or I’m reporting your answer.

Answers

Answer:

Running water makes rock edges very dull because of erosion.

Explanation:

hope this helps  ^_^

What is the correct formula for the missing product from the equation below:
Na2CO3(aq)
+
CaCl2 (aq)
> NaCl +

Answers

Answer:

CaCO3 (s)

Explanation:

This equation is a double replacement equation, which means that since Na and Cl and paired, Ca and CO3 will be paired.

Then, you look at the charge of each element and balance

Ca has a 2+ charge

CO3 has a 2- charge

The 2+ charge and the 2- charge will cancel so there is no need for a  subscript or to balance the equation

The complete equation will be Na2CO3 (aq) + CaCl2(aq) -> NaCl (aq) + CaCO3 (s)

I hope this helps and have a great day!

when a rotting log was turned over, pill bugs, termites , ants , fungi , and earthworms were living there. the termites represent ____ in its
a. an environment
b. a population
c. a niche
d. an abiotic factor

Answers

d. an abiotic factor

Write the name of flame used In charcoal cavity test.why?

Answers

Answer:

the reducing flame also called the carburizing flame.

Explanation:

because it gets the oxides of the unknown salts

At which type of tectonic plate boundary is a volcano least likely to occur?

Answers

Answer: the answer is a

Explanation:

I took the test and got it wrong because someone said the answer was divergent boundary and it’s wrong. I hate them I hate them I hate them. I hate it I hate school

Transform boundary is the type of tectonic plate boundary is a volcano least likely to occur.

What is meant by Transform boundary?A transform fault or transform boundary, sometimes called a strike-slip boundary, is a fault along a plate boundary where the motion is predominantly horizontal. It ends abruptly where it connects to another plate boundary, either another transform, a spreading ridge, or a subduction zone.

Transform boundary is the type of tectonic plate boundary is a volcano least likely to occur.

To learn more about Transform boundary refer:https://brainly.com/question/18190655

#SPJ2

Purpose Question:
If you have a headache, which medicine is the best choice to take?
Your choices are Aspirin, Tylenol or Ecotrin (coated aspirin)

Answers

Answer:

I will take Aspirin if I had a headache

I believe it is Aspirin but i guess it depends on personal choice

Determine if the following would be a buffer system.

H3PO4 and NaH2PO4

H3PO4 and Na2HPO4

Answers

sorry i dont know Explanation:

Did anyone do this worksheet (science)

Answers

i did this my 8th grade year but i got the answer from online. Try looking it up on there. i’m sorry i couldn’t help:(
Other Questions
Owners of the proprietary colonies like South Carolina and Pennsylvaniaencouraged theto their colonies in an effort to increasethe population and wealth of their colonies.O cash cropconstitutionO immigrationOindentured servantO mercantilsmILL MARK BRAINLIEST PLEASE HELP Rewrite each of the following sentences in the affirmative form, using indefinite words.Example: No veo a nadie. -> Veo a alguien.1. Nunca juego al voleibol. -> 2. No tenemos ninguna idea. ->3. No omos a nadie en el jardn. >4. No dice nada. -> 5. No me gusta el bisbol tampoco. -> A/An _________ narrative starts at the beginning and reveals each detail as it happens. Which of the following points is in the solution set of y>-x + 5? A. (0,5)B. (1,3) C. (2,4) f/2 = 5/8 what is the value of f The audience is sympathetic to which type of character?| Alboo protagonistO antagonistO archetypeO stock what is this answer ASAP PLS HELP Most plant growth takes place in the ____________________ of the root Given the definitions of f(c) and g(x) below, find the value of g(f(5)).f(x) = 2x 10g(x) = x2 + 6x 8 Please help me with this question The diagonals of the figure below represent the support beams for a patio covering.BE3010 yardsMAWhat is the length of each support beam?o 10 yards and 10x/3 yardsO 5 yards and 53 yardsO 10 yards and 5 yardsO 15 yards and 5 yards Need Help ASAP Thanks so much in advance... 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! What is the value of the expression: 2/10 5/4?1/504/108/501/2