Which part would best model a cells nucleus

Answers

Answer 1

Answer:

which part of what

Explanation:


Related Questions


4. What is a function of the nucleus of an animal cell?
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
C. It defends the cell from infections.
D. It captures sunlight to produce food.
5. Select a statement that best completes the phrase below. In a plant

Answers

Answer:

A. It is the place where energy is produced.

It stores the genetic information, the DNA (chromosomes).

Explanation:

Answer it correctly please

Answers

The first. One will be Guard cell

Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced

Answers

Answer:

Glucose

Explanation:

Only glucose is produced in the light independent stage of the reaction

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

explain how biodiversity affects ecosystem services.

Answers

ecosystem services provided by biodiversity, such as nutrient cycling, carbon sequestration, pest regulation and pollination, sustain agricultural productivity. Climate change and other stresses have the potential to make major impacts on key functions, such as pollination and pest regulation services.

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

1. What is the major source of energy for the brain

Answers

Explanation:

glucose

The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.

hope its helpful to you #

The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.

What is the brain?

The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.

Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.

The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.

Thus, glucose is the major source of energy for the brain.

To learn more about energy, refer to the link:

https://brainly.com/question/781388

#SPJ2

4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?

Answers

Answer:

They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.

As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.

Answer the following qs :
1- Mention three uses or benefits of fungi ?

Answers

Answer:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Explanation:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Why are there not many vaccines for fungal & parasite disease as we have for viral and bacterial disease?

Answers

Answer:

it is very easy to kill the pathogen by vaccination but it is very difficult to detoxify the toxins produced in the host.

Explanation:

Hopefully this helped!

A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of

Answers

Answer:

Convergence

Explanation:

Define bottleneck effect.


Koyi hai? ✌️​

Answers

Answer:

When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.

Hope this helps ~

Answer:

The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.

2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur ​

Answers

Answer:

option a) is correct.

Explanation:

in IVF the fertilisation is always external.

IVF involves combining eggs and sperm outside the body in a laboratory.

Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas

Answers

Answer:

Nope

Explanation:

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

The __________________ is the tunnel that cuts through the external auditory meatus delivering sound to the ear drum or the _____________________.

Answers

Answer:

The auricle (pinna) is the visible portion of the outer ear. It collects sound waves and channels them into the ear canal (external auditory meatus), where the sound is amplified. The sound waves then travel toward a flexible, oval membrane at the end of the ear canal called the eardrum, or tympanic membrane.

Explanation:

How can carbon can be stored for a short time in the natural cycle?

Answers

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

what is chloride shift ​

Answers

The chloride shift is an exchange of ions that takes place in our red blood cells in order to ensure that no build up of electric change takes place during gas exchange.

What does fat become after the chemical process?

Answers

Answer:

uR mOtHeR

Explanation:

dUnno im sorry and very bored

After we eat food, the digestive system uses enzymes to: break proteins down into amino acids. turn fats into fatty acids. turn carbohydrates into simple sugars (for example, glucose)

In which of these does a chemical change take place?
mixture
compound
solution
none of the above

Answers

Mixture because it’s reacting to a chemical change

Which of the following statements is FALSE?

Answers

Answer:

I'll wait for some possible answers...

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

Answers

Answer:

FM radios and TV remote controls.

Most Americans/Canada say they hope to die __________.

Answers

i think they hope to die at home

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

Why is it necessary for there to be variation in population in order for evolution by natural selection to occur?

Answers

Answer:

There needs to be variations in population in order for natural selection to occur because the entire point of evolution by natural selection is only the best variations will survive. So if there were no variations then there would be no natural selection because the animal's survival rate would be the same no matter how many times they reproduce because there are no different variations being introduced into the species. However, if there are variations then the animal's survival rate could be impacted because of the variations, for example, white mice would be easier to find for predators on a dark surface, while a darker mice would be harder to find for predators on a dark surface, thus, allowing the darker mice to prevail as they have a higher survival rate and the species will slowly evolve into the darker mice. But, if there were no evolution, in this case, then no matter what happens, the white mice would not be able to evolve into a darker mice because there are no such thing as variation. That is why it is necessary for there to be variation in order for evolution by natural selection to occur.

4. Explain the law of conservation of energy.

Answers

Law of conservation state that energy cannot be created or destroyed

As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably?

Answers

Use resources responsibly and don’t waste resources for things you don’t need.

which fungus does contain mycelium?​

Answers

Answer:

Mycelium is part of the fungi kingdom and is the network of threads, called hyphae, from which mushrooms grow. Not all mycelia fruit mushrooms, depending on the environmental conditions, but all mushrooms come from mycelia.

Explanation:

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

The hummingbird is more closely related to a lizard than it is to a dragonfly. Explain why two species that look similar are not necessarily closely related.

Answers

Some species look similar because they evolved in similar environments. Similar environments impose similar challenges, and traits improving survival are favoured. These organisms would not be closely related, however, because they evolved from different species and different regions. This is known as convergent evolution.
Other Questions
what is the rectangular cross hatch chart used for eye test called What evidence does the cladogram provide Although they have changed the face of farming in the usa crops are still regarded with deep. A 24 foot flagpole casts a 20 foot shadow of the building next to it is an 85 foot shadow find the height of the building Calculate the volume of cylinders with the following dimensions ( 22/7). (b) Diameter of the base = 84 cm, height = 1.5 m . ............ your computer if I'm careful?A. Will I useB. Do I useC. Use ID. Could I use. And Why? Solve the system by graphing. Y=2x-9 y=-2x-1 4CorrectDrag each label to the correct location on the image.Name the stages of the water cycle.condensatio17precipitatiomSITevaporationrunoffFreegroundwatNext how many atp are produced in the electron transport chain What was the topic of many ofLangston Hughes' poems duringthe Harlem Renaissance?A. The social and economic status of African-AmericansB. The corruption of our governmentC. How sports was changing our daily livesD. The struggle it was to be an immigrant fromEurope What is the measure of the angle mentioned in the picture below:In the figure below, what is the measure of 70deg125deg55deg180deg Write an algebraic expression that corresponds to "the opposite of a number " Complete the table to evaluate the outcome of each conference. Was the conference successful in its goals? Why or why not? Casablanca Cairo Tehran Yalta Potsdam Date Jan. 1943 Nov. 1943 Nov.Dec. 1943 Feb. 1945 Aug. 1945 Participants FDR, Churchill FDR, Churchill, Chiang FDR, Churchill, Stalin FDR, Churchill, Stalin Truman, Churchill Reason for conference demand unconditional surrender create vision of post-war Asia; cement Chiang as important discuss strategy for defeating Germany set conditions for Russia to enter war against Japan demand that Japan surrender unconditionally Evaluate the outcome of the conference where to find finneon in pokemon brilliant diamond Amare runs 1\10 mile in 2\3 minute. What is his speed in miles per minute? Show your work set of rules and principles that govern a sentence choose a word from the banco de palabras. Two forces of 100 Newtons and 25 Newtonsact concurrently on an object. These two forcescould have a resultant force ofA) 0 NB) 50 NC) 100 ND) 150 N Which character is most motivated by traditional moral expectations, even though she is called a modern woman in the play? Please help for brainliest!!:)