Which two changes would increase the density of ocean water?
A. Increasing the amount of light that enters it
B. Decreasing its salinity
C. Increasing the amount of water that evaporates from it
I D. Decreasing its temperature

Answers

Answer 1

Answer:

The answer is simply D.

Explanation:

One factor that  does affect density is the temperature. In general, most substances become less dense as temperature increases and more dense as temperature decreases.

Answer 2

The amount of water that evaporates from the ocean and the temperature are the two factors that influence its density. So options C and D are both true for this statement.

What is the effect of temperature on density?

The ocean water has more salts and minerals dissolved in it, so it is denser than normal fresh water. Some factors further decrease or increase the density of the ocean water. When the temperature drops, the water cools and ice forms. The ice is denser than the water, so it will sit below it.

As the temperature rises, the water evaporates, increasing salinity because more salts are present in the ocean water than in the water itself. The concentration of salt in the ocean determines the salinity of the ocean, and it can increase the density of ocean water when the concentration of salt is higher.

Hence, the amount of water that evaporates from the ocean and the temperature are the two factors that influence its density. So options c and d are both true for this statement.

Learn more about the density here

https://brainly.com/question/14697097

#SPJ2


Related Questions

If you were stuck on an island, (without any technology,) how would you ask for help?
Explain your answer’s reasoning. If you don’t, then briefly tell how you will live out your life on your island.

Answers

Answer:

I would gather up as many resources as I can and spell SOS On the island where they can seeit spelled and I would grab  A pocket nife and shine in towards the boat,helicopter.etc

Explanation:

Which of the following has the greatest effect
on soil's capacity to retain water?
A Soil color
B Soil particle size
C Soil texture
D Soil fragrance

Answers

The water-holding capacity of a soil is the  the amount of water that a given soil can hold for plants to utilize

The soil particle size has the greatest effect on soil's capacity to retain water.

Soil particle size and organic matter (the soil's composition) are main determinants of water-holding capacity of a soil. Smaller particles (silt and clay) have a bigger surface area than larger sand particles, allowing the soil to hold more water.

Learn more about the water holding capacity of soil: https://brainly.com/question/8464940

HELP PLEASE NEED ANSWER

Answers

Answer:

telophase

Explanation:

What is the probability of short beaks in the offspring of the cross show above

Answers

Answer:

8/16 or 1/2

Explanation:

This question is a dihybrid cross involving two genes, one coding for feather color and the other for beak length. The alleles for green feathers (G) and long beak (L) are dominant over the alleles for yellow feathers (g) and short beak (l).

According to this question, a male with genotype GGLl was crossed with a female with genotype Ggll. The following combination of gametes is produced by each parent:

GGLl - GL, Gl, GL, and Gl

Ggll - Gl, Gl, gl and gl

Using these gametes in a punnet square (see attached image), the following offsprings in the following proportions will be produced.

Green feathers, long beak (GGLl, GgLl) = 8/16 or 1/2

Green feathers, short beak (GGll, Ggll) = 8/16 or 1/2

Hence, the probability of short beaks (ll) in the offspring of the cross is 1/2.

Which of these is an example of a CLIMATE region zone?
A. tropical
B. foggy
C. overcast
D. sunny

Answers

Answer:

tropical

Explanation:

Answer: B foggy

hope i helped others who really need it!

7. HELP URGENT BEAINLYWhat does most cell division produce?

Answers

Answer:

There are two mitosis and meiosis.

One line with red flowers and the other line with violet flowers. You carry out a monohybrid cross and find that all of the F1 offspring have violet flowers, while 97 of 400 F2 offspring have red flowers.
Explain the inheritance of flower colour in this plant species.

Answers

Answer:

See the answer below

Explanation:

The inheritance of flower color in the plant species follows the simple dominance/recessive inheritance of Mendel. The red flower trait did not show up at all at F1 only for it to show up at F2. It simply means that the red flower trait is recessive while the violet flower color is dominant.

Assuming that the allele for violet flower color is designated as R while that of red flower color is designated as r.  The genotype of the violet flower would be true-breeding, RR, while that of red flower color would also be true-breeding rr:

                RR    x    rr

 F1         Rr    Rr    Rr    Rr  

phenotype ratio = all violet flower color

                 Rr    x    Rr

F2          RR    Rr    Rr    rr

phenotype ratio = 3/4 violet flower color and 1/4 red flower color

97 red flower offspring out of 400 is approximately 1/4.

Hence, the inheritance of flower color in the plant obeys a simple dominant/recessive Mendelian law with the violet color trait dominant over the red color trait.

Competition occurs when organisms try to use the same limited resource. True or False

Answers

Answer:

the answer is

true and this organism are called

inter specific organism

The picture shows a 3-D model of a virus called a bacteriophage. Bacteriophages can infect In what way are the bactenophage and E. coli alike? F. They contain antibodies. che produce by tutosis. H They have idenbekl genomes, The lack membrane-bound organelles. Students, dawanywhere on this slide!​

Answers

G is your answer. I took the test.

Bacteriophage and E.coli are alike in the sense that they both lack membrane-bound organelles.

What are bacteriophage?

Viruses that infect bacteria are called bacteriophage. The words bacteriophage mean "bacteria eater". Bacteriophages take over the machinery of host cells to produce copies of themselves and then destroy the host cell in the process.

Bacteriophages are composed of a supercoiled nucleic acid which is surrounded by a protein capsid.

A bacteriophage adheres to the surface the susceptible bacteria and injects its genetic material. This way they occupy the genetic machinery of the host and produce several copies of their own nucleic acid and also the protein capsid to surround it.

The result is the lysis of bacterial cell and release of thousands of bacteriophage viruses which are capable of infecting more bacteria in the same manner.

Bacteriophage are acellular structures lacking any membrane bound cell organelles. E.coli is a kind of prokaryotic bacteria which also lack membrane bound organelles.

Therefore, the correct option is D.

Read more about bacteriophage, here

https://brainly.com/question/14594663

#SPJ6

How do bile salts help in digestion? ​

Answers

They dissolve food in the stomach to easily pass through the intestines

At very large distances from the Sun, its corona turns into the solar wind.
True
False

Answers

Answer:

the question really didnt make sense to me so false..

Explanation:

false

list two examples of temporary change in human​

Answers

Answer:

Being emotional

Frustrations about changes in bodies

Explanation:

During growth stage, there are certain changes that occurs, these changes are either permanent or temporary. Temporary changes are seasonal and end with time as one is transitioning whereas permanent changes like deepening of voice in boys remains and growth of breasts in girls are permanent

how does an organism reproduce by budding

Answers

Budding is a kind of asexual reproduction. It occurs most commonly in some bacteria and yeast. Organisms which reproduces in this fashion are usually very basic organisms that either lack reproductive organs or both female and male reproductive organs are located internally.
Examples of such animals are:
1. flat worms
2. Jelly fish
3. Sea anemones
4. corals.
5. Yeast cells (such as are found in baker's yeast)
The coral reef is a large colony of living organisms identical to each other, which propagate themselves through budding.

Denelle pulled gently on a spring scale. The scale showed a force, but the block did not move. Why not?

Answers

Explanation:

A large force is applied to an object with a small mass

Name a storage protein in our bodies.

Explain the function of this storage protein in our bodies.

Where is this storage protein found?

please help

Answers

Answer:

Storage proteins serve as biological reserves of metal ions and amino acids, used by organisms. They are found in plant seeds, egg whites, and milk. Ferritin is an example of a storage protein that stores iron. Iron is a component of heme, which is contained in the transport protein, hemoglobin and in cytochromes.

Explanation:

Hope this helps.

why did china remain isolated

Answers

Answer:

In the last 50 years or so of the Ming Dyansties, the emperor simply lacked the necessary resources and man power to sustain large amounts of trade, causing China to become isolated from the world.

Explanation:

In the periodic table, vertical columns are called periods.
TRUE
FALSE

Answers

Answer:

FALSE

Explanation:

In the periodic table, vertical columns are called GROUPS.

This is a FALSE statement

The horizontal rows on the periodic table are called periods.

The Sun is a fairly normal star.
True
False

Answers

Answer:

Yes.

Explanation:

The Sun is a medium sized star

What is the difference between speed and velocity in your own words?

Answers

Answer:

Explanation:

The difference between speed and velocity is that speed is a scalar quantity while velocity is a vector quantity.

               

                    hope this helps my friend

What could a weather forecast on Mars be?

Answers

Temperatures on Mars are in the extreme negatives besides on the poles. So very cold and dry. But the poles can get to +70 degrees, so they can be warmer

Answer:

Cold

Explanation

Weather conditions on Mars

Mars is an extremely cold planet with an average temperature around minus-80 degrees. Temperatures can dip to minus-225 degrees around the poles. Periods of warmth are brief — highs can reach 70 degrees for a brief time around Noon at the equator in the summer.

Which are ways of showing probability? Select 4 options.

50%

557

3/4

1 x 10

25%

7/8

Answers

Answer:

50%

3/4

25%

7/8

Explanation:

Probability must be greater than or equal to zero and less than one.

Answer:

A,C,E,F

Explanation:

just took the test

In mice, black fur is dominant to white fur. Two mice with black fur are placed in the same cage and have several litters. Of all the offspring, 7 mice have white fur and 19 mice have black fur. Which of the following crosses could produce this combination?



Question 2 options:

a. BB x bb


b. Bb x bb


c. Bb x Bb


d. bb x bb

Answers

Answer:

I am unsure, but i would go with c.

Explanation:

We just finished learning about this in my class so it is pretty fresh in my mind i just had a little trouble with it when we did it.

Answer: it's most likely to be A.

Woodpeckers peck trees to find food and make nests. What would happen if
most of the trees are cut down?

Answers

Answer:

the wood packers wouldnt have a home to live in anymore. the effect of this means that the habitat for them and other animals is destroyed and they could start to die and become endangered species. this is my opinion

Explanation:

This is from what I have learned so far

1. If you were a transformer, what vehicle would you turn into?

2. What laws would you abolish if you could? What laws would you create?

3. If you were a food, what food would you be?

4. What animal would be way better if it was covered in scales?

5. What would be your strategy for a zombie apocalypse?

6. If you could be the CEO of any company, what company would you choose?

Answers

Answer:

1. I would turn into Lambo (black and neon green)

2. I would abolish the laws that require children to go to school. I would create a law saying that you can't be a stuck up p*rv if you want to be president.

3. I would be bacon. Don't ask.

4. Hedgehog. ;-;

5. Break into Ariana Grande's house and protect her.

6. Amazon because Jeff Bezos is literally the RICHEST man in the world atm.

Sorry it took so long T^T

This was fun doee

Help please thank you so much

Answers

Answer: A!
Hope it helps :D

PLEASE HELP ME!!! WILL MARK BRAINLIEST!

Which term best describes the reaction that makes pyruvic acid during cellular respiration?

A) exothermic reaction

B) endothermic reaction

C) physical reaction

D) digestive reaction

Answers

Answer:

d)

Explanation:

digestive reaction

D ) digestive reaction

what is the difference between cell structure and cell function? ​

Answers

Answer:

These cells have a membrane-bound nucleus that houses their DNA and contain extensive internal organelles (“little organs”) that perform specific functions. ... Differences occur in size, shape, and presence and number of various organelles and other structures. Each cell's structure correlates with its specific function.

Explanation:

Answer:

A cell can be defined as the smallest unit of life and an example include muscle cells. An aggregation of cells form tissues.

The major difference between a cell structure and cell function is in their functions and physical properties.

Cell structure: This talks about how the cells look like when viewed. A call contains components such as the nucleus, cytoplasm, cell membrane etc and each has their various functions to ensure the organisms/animals are able to perform various life activities.

Cell function: This on the other hand refers to the various functions which a cell is able to perform and this is dependent on the component in question such as the nucleus which controls cell activities and cytoplasm which provides support and helps to house other organelles.

Read more on  https://brainly.com/question/19715268

What is one way the body raises its temperature?

Answers

Vasoconstriction
Definition-The blood vessels under your skin become narrower. This decreases blood flow to your skin, retaining heat near the warm inner body.

what happened to the red blood cells after the sugar was added to the solution

Answers

Answer:

Studies revealed that glucose binds with the RBC membrane and intracellular proteins and increases membrane rigidity. The thing is that the concentration of glucose in the solution used is less than compared to the concentration of the same inside RBC and the cells swell up due to endometriosis.

Bromothymol blue (BTB) is a chemical that can be used as an indicator of the pH of a solution. Because CO2 produces an acid in water, BTB can indirectly measure how much CO2 is present in a solution. When placed in solutions with neutral pH (little CO2), the solution appears green. In solutions with low pH (high CO2), the solution appears yellow.

A teacher performed a demonstration to investigate how photosynthesis and respiration cycle carbon and oxygen. She placed a few drops of BTB in a test tube containing distilled water. Because distilled water has a neutral pH, the solution appeared green. The teacher used a straw to blow into the solution, and the solution turned yellow. She then placed an aquatic plant into the test tube, covered it to keep it air tight, and placed it under a light for 24 hours.

What color would the solution in the test tube be after being in the light, and what would it be if it were then placed in the dark for 24 hours, and why?
A
Green after being placed in the light because the plant would remove CO2 by photosynthesis; yellow after being placed in the dark because the plant would release CO2 by respiration.

B
Yellow after being placed in the light because the plant would release CO2 by photosynthesis; green after being placed in the dark because the plant could not photosynthesize in the dark.

C
Green after being placed in the light because the plant would remove CO2 by photosynthesis; green after being placed in the dark because no CO2 would enter the tube since it is air tight.

D
Yellow after being placed in the light because the plant would release CO2 by photosynthesis; yellow after being placed in the dark because no CO2 could leave the tube since it is air tight.

Answers

Answer:

A. Green after being placed in the light because the plant would remove CO2 by photosynthesis; yellow after being placed in the dark because the plant would release CO2 by respiration.

Explanation:

According to this question, Bromothymol blue (BTB) is a chemical that can be used as an indicator of the pH of a solution. The presence or absence of CO2 in a solution decreases or increases the pH of the solution respectively.

- BTB appears green in a neutral pH i.e. little CO2

- BTB turns yellow in a low pH i.e. high CO2

Plants, in the presence of light, will perform photosynthesis and use CO3 as a reactant while in the dark, will perform cellular respiration and release CO2 as a waste product. Hence, in this case where an aquatic plant was placed into a test tube and covered it to keep it air tight.

- When placed under light for 24 hours, the aquatic plant will undergo photosynthesis and remove CO2 from the solution to make the solution appear GREEN due to neutral pH.

- When placed in the dark for 24 hours, the aquatic plant will undergo cellular respiration and release CO2 into the solution making the solution appear YELLOW due to low pH.

Other Questions
Help asap please!! I will mark you as brainliest :) As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec Moritz rescued his friend from a dangerous ocean rip current by pulling his friend from the water. Which activity most likely prepared him for this?enrolling in a class about swimming safetytaking a CPR training classwatching online shows about being a lifeguardtalking with friends who are lifeguards 2000x5000000000000000000000000000